View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10903_high_5 (Length: 274)
Name: NF10903_high_5
Description: NF10903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10903_high_5 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 253
Target Start/End: Original strand, 3573618 - 3573870
Alignment:
| Q |
1 |
ggcatggttgattgtatgaccagctccgattcatgcagcagaattgtagttcaagggtcaatttaacttatcttgctcatttaactttgttctatggatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3573618 |
ggcatggttgattgtatgaccagctccgattcatgcagcagaattgtagttcaagggtcaatttaacttatcttgctcatttaactttgttctatggatg |
3573717 |
T |
|
| Q |
101 |
attaagttgtactgctataatgatttgatcaattatgaatttatgatcaaaagttttgctatcacagaaagtactatcagtgtcatggaattggcaatca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
3573718 |
attaagttgtactgctataatgatttgatcaattatgaatttatgatcaaaagttttgctatcacagaaagtattatcagtgtcatggatttggcaatca |
3573817 |
T |
|
| Q |
201 |
atttatgatcagagacatggtttgtgtgcatttgtaaattgcaaaaggctgct |
253 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3573818 |
atttatgatcagagacatggtttgtgtgcatttgtaaattgcaaaaggctgct |
3573870 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University