View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10903_high_6 (Length: 259)
Name: NF10903_high_6
Description: NF10903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10903_high_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 206; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 33900714 - 33900940
Alignment:
| Q |
17 |
agaagattttatgttggagcctataaagctttgagcaaaggttatgcaaacatggatttgttgatagcattaggaacaaatgcagcttatttctattctg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33900714 |
agaagattttatgttggagcctataaagctttgagcaaaggttatgcaaacatggatttgttgatagcattaggaacaaatgcagcttatttctattctg |
33900813 |
T |
 |
| Q |
117 |
tttatgttgttggaagagctacattttcttcccatttcgaaggaagtgannnnnnngaaacaagttctatgcttatttcttttattctacttggcaagta |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33900814 |
tttatgttgttggaagagctacattttcttcccatttcgaaggaagtgatttttttgaaacaagttctatgcttatttcttttattctacttggcaagta |
33900913 |
T |
 |
| Q |
217 |
tttggaagtgttggctaaagggaaaac |
243 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
33900914 |
tttggaagtgttggctaaagggaaaac |
33900940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 193 - 243
Target Start/End: Original strand, 33918416 - 33918466
Alignment:
| Q |
193 |
ttcttttattctacttggcaagtatttggaagtgttggctaaagggaaaac |
243 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33918416 |
ttcttttattctatttggcaagtatttggaagtgttggctaaagggaaaac |
33918466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 68 - 121
Target Start/End: Complemental strand, 2782021 - 2781968
Alignment:
| Q |
68 |
atggatttgttgatagcattaggaacaaatgcagcttatttctattctgtttat |
121 |
Q |
| |
|
|||||| || |||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
2782021 |
atggatgtgctgatagcactgggaacaaatgcagcttatttctattctgtttat |
2781968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University