View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10903_high_9 (Length: 204)
Name: NF10903_high_9
Description: NF10903
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10903_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 44 - 188
Target Start/End: Complemental strand, 50445485 - 50445341
Alignment:
| Q |
44 |
tcctaaagattggactacataagaataaaatgctcaacaatctgagtttccacaaattcgataaaattgtctttcaatgtttgtctttgagtggaagata |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50445485 |
tcctaaagattggactacataagaataaaatgctcaacaatctgagtttccacaaattccataaaattgtctttcaatgtttgtctttgagtggaagata |
50445386 |
T |
 |
| Q |
144 |
catgattgtttctcattatgcagaatgttgatagaagactcaaat |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50445385 |
catgattgtttctcattatgcagaatgttgatagaagactcaaat |
50445341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University