View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10904_low_8 (Length: 242)
Name: NF10904_low_8
Description: NF10904
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10904_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 117; Significance: 1e-59; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 32552041 - 32552252
Alignment:
| Q |
1 |
taaccattctcaaaagttgaagctttgagaatggcatttacaagattaagttggctatcaaattcaaacaatacatgctcaaaaccatgaccatgaacac |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32552041 |
taactattctcaaaagttgaagctttgagaatggcatttacaagattaacttggctatcaaattcaaacaatacatgctcaaaaccatgaccatgaacac |
32552140 |
T |
|
| Q |
101 |
ggatgtgttaaccacactcgttactcgtataagaagtacaaaaggacgnnnnnnnnnnnntataaaggcatgtaaatatgcgactaccaccccctaaata |
200 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||||||| || |||||||| |||||||||||||||||||||||| |
|
|
| T |
32552141 |
ggatgtgt-------actc--tactcgtataagaagtacaaaaggacgaaaaaacaaaaatacaaaggcat---cgtatgcgactaccaccccctaaata |
32552228 |
T |
|
| Q |
201 |
gggtaaaatacaaaaaccccaact |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
32552229 |
gggtaaaatacaaaaaccccaact |
32552252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University