View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10905_high_8 (Length: 297)
Name: NF10905_high_8
Description: NF10905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10905_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 257; Significance: 1e-143; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 257; E-Value: 1e-143
Query Start/End: Original strand, 5 - 289
Target Start/End: Original strand, 8570099 - 8570381
Alignment:
| Q |
5 |
aaatggaagtataattcattgtttctgtttgcttatgagaaagaatgtgacctcgagtaggggtcatttatagttcaacatcaataattaatgaaagcaa |
104 |
Q |
| |
|
|||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8570099 |
aaatggaa-tataatatattgtttctgtttgcttatgagaaagaatgtgacctcgagtaggggtcatttatagttcaacatcaataattaatgaaagcaa |
8570197 |
T |
|
| Q |
105 |
tcgaacaataaaagaagaagcagacaaggtagctgcttttttgatcatattcttctaataaaggctaattaagtaagtattatttgattcatgtggtagc |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
8570198 |
tcgaacaataaaagaagaagcagacaaggtagctgcttttttgatcatattcttctaataaaggctaattaagtaagtaata-ttgattcatgtggtagc |
8570296 |
T |
|
| Q |
205 |
taagtaagtcatcaaaggggtcgagtatgtcttccagttgccctaccacaaagtaatgcattcttaggaatagggtattcatctc |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8570297 |
taagtaagtcatcaaaggggtcgagtatgtcttccagttgccctaccacaaagtaatgcattcttaggaatagggtattcatctc |
8570381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 278
Target Start/End: Original strand, 53748445 - 53748507
Alignment:
| Q |
216 |
tcaaaggggtcgagtatgtcttccagttgccctaccacaaagtaatgcattcttaggaatagg |
278 |
Q |
| |
|
||||||||| || |||||||| ||| |||||||||||||||| ||||||||| |||||||| |
|
|
| T |
53748445 |
tcaaagggggcgggtatgtctcccacttgccctaccacaaagacgtgcattctttggaatagg |
53748507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University