View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10905_low_13 (Length: 271)
Name: NF10905_low_13
Description: NF10905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10905_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 7 - 235
Target Start/End: Complemental strand, 40546557 - 40546329
Alignment:
| Q |
7 |
gaagcagagaagagatgcagggaagaaaaaactcgagtgaaaatactaaagggagataaaatagcgacaacgggttaaaataggcttgaatagggttgga |
106 |
Q |
| |
|
|||||| || ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40546557 |
gaagcaaagtagagatgcagggaagaaaaaacttgagtgaaaatactaaagggagataaaatagcgacaacgggttaaaataggcttgaatagggttgga |
40546458 |
T |
|
| Q |
107 |
taagaatatgcatctgctagtaaggaagcagataagttacaaccaacaaagtcacaaaaattgcttttaagacaaatataagttactgccaaccaagtta |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40546457 |
taagaatatgcatctgctagtaaggaagcagataagttacaaccaacaaagtcacaaaaattgcttttaagacaaatataagttactgccaaccaagtta |
40546358 |
T |
|
| Q |
207 |
ttgtgaagaataacagtttgagccggtgc |
235 |
Q |
| |
|
||||| ||||||||||||||||||||||| |
|
|
| T |
40546357 |
ttgtgcagaataacagtttgagccggtgc |
40546329 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University