View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10905_low_15 (Length: 258)
Name: NF10905_low_15
Description: NF10905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10905_low_15 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 5 - 222
Target Start/End: Complemental strand, 40546546 - 40546329
Alignment:
| Q |
5 |
gagaagcagagaagaaaaaactcgagtgaaaatactaaagggagataaaatagcgacaacgggttaaaataggcttgaatagggttggataagaatatgc |
104 |
Q |
| |
|
|||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40546546 |
gagatgcagggaagaaaaaacttgagtgaaaatactaaagggagataaaatagcgacaacgggttaaaataggcttgaatagggttggataagaatatgc |
40546447 |
T |
 |
| Q |
105 |
atctgctagtaaggaagcagataagttacaaccaacaaagtcacaaaaattgcttttaagacaaatataagttactgccaaccaagttattgtgaagaat |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
40546446 |
atctgctagtaaggaagcagataagttacaaccaacaaagtcacaaaaattgcttttaagacaaatataagttactgccaaccaagttattgtgcagaat |
40546347 |
T |
 |
| Q |
205 |
aacagtttgagccggtgc |
222 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
40546346 |
aacagtttgagccggtgc |
40546329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University