View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10905_low_16 (Length: 254)
Name: NF10905_low_16
Description: NF10905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10905_low_16 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 15702589 - 15702796
Alignment:
| Q |
1 |
tgttgagaacagatgaggttttgtggaggcagagaagtatggcagtatggttgaaggatggtgatagaaatacaaaaattttccatagcaaggccgacca |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15702589 |
tgttgagaacagataaggttttgtggaggcagaggagtagggcagtatggttgaaggatggggatagaaatacaaaaattttccatagcaaggccgacca |
15702688 |
T |
 |
| Q |
101 |
gaggaggaaagcaaatgcaattaagaaactgaaagatgtcgacggagtgtggtggaaaggtgatgaccatctagaaagactcttaacctcttatttctct |
200 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15702689 |
gaggaggaaaacaaatgcaattaagaaactgaaagatgtcttcggagtgtggtggaaaggtgatgaccatctagaaagactcttaacctcttatttctct |
15702788 |
T |
 |
| Q |
201 |
gatatttt |
208 |
Q |
| |
|
|||||||| |
|
|
| T |
15702789 |
gatatttt |
15702796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 54 - 86
Target Start/End: Original strand, 23378347 - 23378379
Alignment:
| Q |
54 |
aaggatggtgatagaaatacaaaaattttccat |
86 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
23378347 |
aaggatggtgatagaaatacaaaaaatttccat |
23378379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University