View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10905_low_6 (Length: 380)
Name: NF10905_low_6
Description: NF10905
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10905_low_6 |
 | |
|
| [»] scaffold0149 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0149 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: scaffold0149
Description:
Target: scaffold0149; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 19 - 195
Target Start/End: Complemental strand, 31048 - 30872
Alignment:
| Q |
19 |
ccgacaaccatcattgcattgcaagcttagcaagaaagcatctcgaaaatatcaaggtcgtctgttgattttcaaaagtattacaaactaattaagtcat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31048 |
ccgacaaccatcattgcattgcaagcttagcaagaaagcatctcaaaaatatcaaggttgtctgttgattgtcaaaagtattacaaactaattaagtcat |
30949 |
T |
|
| Q |
119 |
aaagacgataagggtttcaaagaaacagtttcaaaccgaacgtcggcccaacaacgatttactaatgaaatcccaac |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
30948 |
aaagacgataagggtttcaaagaaacagtttcaaaccgaacctcggcccaacaaagatttactaatgaaatcccaac |
30872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 285
Target Start/End: Complemental strand, 38331930 - 38331873
Alignment:
| Q |
228 |
aaggtaacatgtgaacttgaccgcacaagaatacgaccttaacatgatattggatgtt |
285 |
Q |
| |
|
||||| || |||| |||||||| ||||| ||||| ||||||| ||||||||||||||| |
|
|
| T |
38331930 |
aaggtcacttgtgcacttgaccacacaaaaataccaccttaagatgatattggatgtt |
38331873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University