View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10906_low_6 (Length: 238)
Name: NF10906_low_6
Description: NF10906
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10906_low_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 18 - 222
Target Start/End: Original strand, 27762154 - 27762358
Alignment:
| Q |
18 |
atccatctgtacatctttgaataaagtggctccacacttctttaccttattgagcttggaaggactcacttttcacttaaattaagacattaaactctca |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
27762154 |
atccatctgtacatctttgaataaagtggctccacacttctttaccttattgagcttggaaggactcacttttgacttaaattaagacattacactctca |
27762253 |
T |
 |
| Q |
118 |
tctcttcaaaccgaccctcaaatttagttagttggggacaataagcggcgagtagcacgcgacacaagtgagtgtttgtttatctccatcactaactcaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27762254 |
tctcttcaaaccgaccctcaaatttagttagttggggacaataagcggcgagtagcacgcgacacaagtgagtgtttgtttatctccatcactaactcaa |
27762353 |
T |
 |
| Q |
218 |
gtcac |
222 |
Q |
| |
|
||||| |
|
|
| T |
27762354 |
gtcac |
27762358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University