View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10907_low_10 (Length: 248)
Name: NF10907_low_10
Description: NF10907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10907_low_10 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 151; Significance: 5e-80; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 94 - 248
Target Start/End: Original strand, 48159229 - 48159383
Alignment:
| Q |
94 |
gtggtatagtagcatacctgcattccttgagcaaacaagcacaagttttgagtgcatcaacagcatcagctgatggaacaatcattaaaatagaaaccag |
193 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48159229 |
gtggtatagcagcatacctgcattccttgagcaaacaagcacaagttttgagtgcatcaacagcatcagctgatggaacaatcattaaaatagaaaccag |
48159328 |
T |
|
| Q |
194 |
tatggcaactaattggattatgcgtgaatttctccaatcttcaagaacaacaagc |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48159329 |
tatggcaactaattggattatgcgtgaatttctccaatcttcaagaacaacaagc |
48159383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 10 - 82
Target Start/End: Original strand, 48159132 - 48159204
Alignment:
| Q |
10 |
gcataggcggggacacctaaagagttatatgtaggtggtttagagttgaatctctgctactaacatttggcaa |
82 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
48159132 |
gcataggcagggacacctaaagagttatatgtaggtggtttagagttgaatatctgctactaacatttggcaa |
48159204 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University