View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10907_low_12 (Length: 207)
Name: NF10907_low_12
Description: NF10907
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10907_low_12 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 41785105 - 41784910
Alignment:
| Q |
1 |
cgctatcgttttcctttaaaaaatttgatatctcttcacctctttgtatcattgctgctttcagttcatggtttctatcctgcagggccttattttcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785105 |
cgctatcgttttcctttaaaaaatttgatatctcttcacctctttgtatcattgctgctttcagttcatggtttctatcctgcagggccttattttcatt |
41785006 |
T |
 |
| Q |
101 |
catcagttgtttaatctcataatttgtatctcttaactgctcttccaactcatttctctgattgatttgagtttccaattcgagttccatgttctt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785005 |
catcagttgtttaatctcataatttgtatctcttaactgctcttccaactcatttctctgattgatttgagtttccaattcgagttccatgttctt |
41784910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University