View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10908_high_12 (Length: 334)
Name: NF10908_high_12
Description: NF10908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10908_high_12 |
 | |
|
| [»] scaffold0018 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 256; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 256; E-Value: 1e-142
Query Start/End: Original strand, 15 - 303
Target Start/End: Complemental strand, 41504216 - 41503928
Alignment:
| Q |
15 |
ggcccacattctttgaggttgatttcgtattctttgagttcgggctttgaaggtgtgtcggggttccagcggtagatttggaannnnnnnagaacggtgg |
114 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
41504216 |
ggcccacattctttgaggttgatttcgtattctttgagttcgggctttgaaggtgtgtcggggttccagcggtagatttggaatttttttaagacggtgg |
41504117 |
T |
|
| Q |
115 |
tgtcgcgggctttgggggaggcttgttgggcttgggcttcggaggcatgggctcggaggagggttagtcgggaggttggggaggatgagatgcggtggat |
214 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41504116 |
tgtcgcgagctttgggggaggcttgttgggcttgggcttcggaggcatgggctcggaggagggttagtcgggaggttggggaggatgagatgcggtggat |
41504017 |
T |
|
| Q |
215 |
tgctctcttgagcatagttgaagccattgttgctggaaacgatggaaatgggaaagatacctaaataccaaaattcatttgaagtagat |
303 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41504016 |
tgctctcttgagcatagttgaagccattgttgctggaaacgatggaaatgggaaagatacctaaataccaaaattcatttgaagtagat |
41503928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 15 - 246
Target Start/End: Complemental strand, 155738 - 155507
Alignment:
| Q |
15 |
ggcccacattctttgaggttgatttcgtattctttgagttcgggctttgaaggtgtgtcggggttccagcggtagatttggaannnnnnnagaacggtgg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || ||||||| |
|
|
| T |
155738 |
ggcccacattctttgaggttgatttcgtattctttgagttcgggctttgaaggtgtgtcggggttccaacggtagatttggaatttttttaggacggtgg |
155639 |
T |
|
| Q |
115 |
tgtcgcgggctttgggggaggcttgttgggcttgggcttcggaggcatgggctcggaggagggttagtcgggaggttggggaggatgagatgcggtggat |
214 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| || ||| |
|
|
| T |
155638 |
tgtcgcgggctttgggggagacttgttgggcttgggcttcggaggcatgggctcggaggagggttagtcgggaggttggggaagatgagatgctgttgat |
155539 |
T |
|
| Q |
215 |
tgctctcttgagcatagttgaagccattgttg |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
155538 |
tgctctcttgagcatagttgaagccattgttg |
155507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University