View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10908_high_17 (Length: 256)
Name: NF10908_high_17
Description: NF10908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10908_high_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 33386030 - 33385806
Alignment:
| Q |
18 |
gttacactctacagaatccatcccattatttatgaactcttgccactaatatgcatcaaaagaagacaaaagttcttggaggtttgctggatcctcctat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33386030 |
gttacactctacagaatccatcccattatttatgaactcttgccactaatatgcatcaaaagaagacaaaacttcttggaggtttgctggatcctcctat |
33385931 |
T |
|
| Q |
118 |
aatgtatagaccatgtaattggactcttgccagcttcatgtttgattacgatcttcttgtacacctttaggcatgtttcttccatcaattattttggtgt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33385930 |
aatgtatagaccatgtaattggactcttgccagcttcatgtttgattatgatcttcttgtacacctttaggcatgtttcttccatcaattattttggtgt |
33385831 |
T |
|
| Q |
218 |
tttttgaatctctgcttttgatgtc |
242 |
Q |
| |
|
|||||||||| ||||||| ||||| |
|
|
| T |
33385830 |
tttttgaatcattgctttttatgtc |
33385806 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 185 - 234
Target Start/End: Original strand, 25428240 - 25428289
Alignment:
| Q |
185 |
taggcatgtttcttccatcaattattttggtgttttttgaatctctgctt |
234 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||| ||||||| ||||| |
|
|
| T |
25428240 |
taggcatgttcctcccatcaattattttggtgttttctgaatctttgctt |
25428289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University