View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10908_low_16 (Length: 275)
Name: NF10908_low_16
Description: NF10908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10908_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 19 - 222
Target Start/End: Complemental strand, 41361918 - 41361717
Alignment:
| Q |
19 |
agtgggcctttatgttatttttggggatttgtaggcattgttgttttttgtagatgtgatatttcactttgattaatatttacgagtttgtttgaaaatg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41361918 |
agtgggcctttatgttatttttggggatttgtaggcattgtt--tttttgtagatgtgatatttcactttgattaatatttacgagtttgtttgaaaatg |
41361821 |
T |
|
| Q |
119 |
aaatttgaataaaaaacttttttgacaacgaatctatcttggtttacattgttgattatgctctcaatcagcggtgaactgattctctaaagtttgatgg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41361820 |
aaatttgaataaaaaacttttttgacaacgaatctatcttggtttacattgttgattatgcactcaatcagcggtgaactgattctctaaagtttgatgg |
41361721 |
T |
|
| Q |
219 |
attg |
222 |
Q |
| |
|
|||| |
|
|
| T |
41361720 |
attg |
41361717 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 56 - 179
Target Start/End: Complemental strand, 41360708 - 41360585
Alignment:
| Q |
56 |
ttgttgttttttgtagatgtgatatttcactttgattaatatttacgagtttgtttgaaaatgaaatttgaataaaaaacttttttgacaacgaatctat |
155 |
Q |
| |
|
|||||| |||||||||||| ||||||| ||||||| |||| || ||||||||||||| ||||||| |||||||||||| ||| || |||||||| |
|
|
| T |
41360708 |
ttgttgatttttgtagatgagatattttactttgactaatgcctatgagtttgtttgaagttgaaattagaataaaaaactcatttagtaaggaatctat |
41360609 |
T |
|
| Q |
156 |
cttggtttacattgttgattatgc |
179 |
Q |
| |
|
|||||| | ||||||||||||| |
|
|
| T |
41360608 |
cttggtggaacttgttgattatgc |
41360585 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University