View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10908_low_17 (Length: 262)
Name: NF10908_low_17
Description: NF10908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10908_low_17 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 17 - 262
Target Start/End: Original strand, 6414958 - 6415203
Alignment:
| Q |
17 |
atagagttcaagtttagaaggagatatatagttgctttgcaaacatttttcataatctcctttgtctaattcttcgtgcttgtcaacctctaaattcacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
6414958 |
atagagttcaagtttagaaggagatatatagttgctttgcaaacatttttcataatctcctttgtctaattcttcgtggttgtcaacctctaaattcacc |
6415057 |
T |
 |
| Q |
117 |
atgaaaagggtttttggcgtcgaacctcattgatagcctgaattaaaatttacaagaacttgatccaagttaaaattttcgtttttcttgccctgttttg |
216 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
6415058 |
acgaaaagggtttttggcgtcgaacctcattgatagcctgaattacaatttacaagaacttgatccaagttaaaaattttgtttttcttgccctgttttg |
6415157 |
T |
 |
| Q |
217 |
aagtttcagcatgactagaaactctagcagtttgtttgttttgctt |
262 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6415158 |
aagtttcggcatgacttgaaactctagcagtttgtttgttttgctt |
6415203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University