View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10909_high_10 (Length: 236)
Name: NF10909_high_10
Description: NF10909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10909_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 13 - 216
Target Start/End: Complemental strand, 47301218 - 47301015
Alignment:
| Q |
13 |
gagcagagatgttggggttttgagagatgatgatgtctttggatggtgaatttgggtggtcgggattgggtggtactgtcggtgcttgccgtggacggtc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47301218 |
gagcagagatgttggggttttgagagatgatgatgtctttggatggtgaatttgggtggtcgggattgggtggtactgtcggtgcttgccgtggacggtc |
47301119 |
T |
 |
| Q |
113 |
gacggtgccgtcgctgtagactgtgatataggtaggaatttctgagatgatgcgttttgttgcatcggtggtgatggatgccattgattcagagatgtta |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
47301118 |
gacggtgccgtcgctgtagactgtgatataggtaggaatttctgagatgatgtgttttgttgcatcggtggtgatggatgccattgattcagagttgtta |
47301019 |
T |
 |
| Q |
213 |
gaaa |
216 |
Q |
| |
|
|||| |
|
|
| T |
47301018 |
gaaa |
47301015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 13 - 208
Target Start/End: Complemental strand, 47304116 - 47303927
Alignment:
| Q |
13 |
gagcagagatgttggggttttgagagatgatgatgtctttggatggtgaatttgggtggtcgggattgggtggtactgtcggtgcttgccgtggacggtc |
112 |
Q |
| |
|
|||| ||||| |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
47304116 |
gagcggagatattggggttttgagagatgatgatgtctttggatggtgagtttgggtggttgggattgggtggtaccgtcggtggttgccgtggacggtc |
47304017 |
T |
 |
| Q |
113 |
gacggtgccgtcgctgtagactgtgatataggtaggaatttctgagatgatgcgttttgttgcatcggtggtgatggatgccattgattcagagat |
208 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||| ||||| ||| |||||| | |||||||||| |||||||||||||||||| |
|
|
| T |
47304016 |
gactgtgccgtcgctgtagactgtgatataggtaggaatttcagagataatgtgttttggtacatcggtggt------tgccattgattcagagat |
47303927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 13 - 209
Target Start/End: Complemental strand, 17841346 - 17841150
Alignment:
| Q |
13 |
gagcagagatgttggggttttgagagatgatgatgtctttggatggtgaatttgggtggtcgggattgggtggtactgtcggtgcttgccgtggacggtc |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
17841346 |
gagcggagatgttggggttttgagagatgatgatatctttggatggtgaatttgggtggtcgggattgggtgagacagtcggtgcttgccgtggacggtc |
17841247 |
T |
 |
| Q |
113 |
gacggtgccgtcgctgtagactgtgatataggtaggaatttctgagatgatgcgttttgttgcatcggtggtgatggatgccattgattcagagatg |
209 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||| ||||||||| ||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
17841246 |
gacggtgccgtcgctgtagactgtgatgtaggtaggaatttcagagatgatgtgttttgttgtatctgtggtgatggatgccattgattcagagatg |
17841150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University