View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10909_low_15 (Length: 209)
Name: NF10909_low_15
Description: NF10909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10909_low_15 |
 |  |
|
| [»] scaffold0182 (3 HSPs) |
 |  |
|
| [»] chr8 (151 HSPs) |
 |  |
|
| [»] scaffold0283 (2 HSPs) |
 |  |
|
| [»] chr7 (161 HSPs) |
 |  |
|
| [»] chr6 (104 HSPs) |
 |  |
|
| [»] chr1 (170 HSPs) |
 |  |
|
| [»] chr3 (179 HSPs) |
 |  |
|
| [»] scaffold0594 (2 HSPs) |
 |  |
|
| [»] scaffold0014 (3 HSPs) |
 |  |
|
| [»] chr4 (181 HSPs) |
 |  |
|
| [»] chr2 (121 HSPs) |
 |  |
|
| [»] scaffold0022 (2 HSPs) |
 |  |
|
| [»] scaffold0951 (1 HSPs) |
 |  |  |
|
| [»] scaffold0922 (1 HSPs) |
 |  |
|
| [»] scaffold0606 (1 HSPs) |
 |  |
|
| [»] scaffold0474 (2 HSPs) |
 |  |
|
| [»] scaffold0370 (4 HSPs) |
 |  |
|
| [»] scaffold0272 (4 HSPs) |
 |  |
|
| [»] scaffold0122 (2 HSPs) |
 |  |
|
| [»] scaffold0035 (2 HSPs) |
 |  |
|
| [»] scaffold0016 (2 HSPs) |
 |  |  |
|
| [»] scaffold0005 (2 HSPs) |
 |  |
|
| [»] scaffold0001 (2 HSPs) |
 |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |
|
| [»] scaffold0693 (2 HSPs) |
 |  |  |
|
| [»] scaffold0328 (2 HSPs) |
 |  |  |
|
| [»] scaffold0213 (1 HSPs) |
 |  |  |
|
| [»] scaffold0121 (3 HSPs) |
 |  |  |
|
| [»] scaffold0864 (1 HSPs) |
 |  |
|
| [»] scaffold0777 (1 HSPs) |
 |  |
|
| [»] scaffold0352 (2 HSPs) |
 |  |
|
| [»] scaffold0078 (2 HSPs) |
 |  |
|
| [»] scaffold1171 (1 HSPs) |
 |  |  |
|
| [»] scaffold1067 (2 HSPs) |
 |  |  |
|
| [»] scaffold0154 (2 HSPs) |
 |  |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0592 (1 HSPs) |
 |  |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
| [»] scaffold0227 (1 HSPs) |
 |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 3e-53; HSPs: 155)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 41761636 - 41761745
Alignment:
| Q |
1 |
ttattctcaatccactcccaatttaattttggtctatgtacttatatagcttttcgttatttcacctaaagcccttgtaggtattaacaaagaatagtac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
41761636 |
ttattctcaatccactcccaatttaattttggtctatgtacttatatagcttttcgttatttcacctaaaacccttgtaggtattaacaaagaatagtac |
41761735 |
T |
 |
| Q |
101 |
aaaaccttag |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
41761736 |
aaaaccttag |
41761745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 31456171 - 31456119
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31456171 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
31456119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 26151794 - 26151849
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
26151794 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26151849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 1055371 - 1055419
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
1055371 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
1055419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 2710647 - 2710595
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
2710647 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
2710595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 3020904 - 3020852
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
3020904 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
3020852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 8339962 - 8340014
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
8339962 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
8340014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 23263148 - 23263200
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
23263148 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23263200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 26323685 - 26323633
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
26323685 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26323633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 34169098 - 34169046
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
34169098 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34169046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 34606680 - 34606628
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
34606680 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34606628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 34734383 - 34734331
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
34734383 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34734331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 35306713 - 35306765
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
35306713 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
35306765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 35307012 - 35306960
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
35307012 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35306960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 40687669 - 40687721
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
40687669 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40687721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 40767891 - 40767943
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
40767891 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40767943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 42739897 - 42739845
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
42739897 |
ttaattgcacttttggacccctatctttttaaaagttgcggttatgaacccct |
42739845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 7623833 - 7623778
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
7623833 |
ggtttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
7623778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 8755013 - 8755068
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
8755013 |
ggtttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
8755068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 16597041 - 16597096
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
16597041 |
ggtttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
16597096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 159 - 206
Target Start/End: Original strand, 23499971 - 23500018
Alignment:
| Q |
159 |
aattgcacttttggacccctttcttttcaaaagttgcggttatgaacc |
206 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23499971 |
aattgcacttttggacccctatcttttcaaaagttgcggttatgaacc |
23500018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 27264418 - 27264363
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
27264418 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27264363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 29183133 - 29183188
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
29183133 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29183188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 34082099 - 34082154
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
34082099 |
ggtttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
34082154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 154 - 208
Target Start/End: Complemental strand, 25566855 - 25566801
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccc |
208 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
25566855 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccc |
25566801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 34082411 - 34082361
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
34082411 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatgcaccc |
34082361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 223204 - 223152
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
223204 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
223152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 2546374 - 2546426
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| ||||||||||||||| |
|
|
| T |
2546374 |
ttaattgcacttttggacccctatctttccaaaagttacggttatgaacccct |
2546426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 2710343 - 2710395
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
2710343 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
2710395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 3020597 - 3020649
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
3020597 |
ttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
3020649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 4125447 - 4125499
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
4125447 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
4125499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 5088382 - 5088330
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
5088382 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5088330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 5891793 - 5891745
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
5891793 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
5891745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 13765262 - 13765314
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
13765262 |
ttaattgcacttttcgacccctatcttttcaaaagttgcggttatggacccct |
13765314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 14647699 - 14647751
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
14647699 |
ttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
14647751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 15526707 - 15526759
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
15526707 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
15526759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 15738383 - 15738331
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||| |||||| |
|
|
| T |
15738383 |
ttaattgcacttttggacccatatcttttcaaaagttgcggttatggacccct |
15738331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 16521157 - 16521209
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
16521157 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
16521209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 16666076 - 16666128
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
16666076 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
16666128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20974463 - 20974515
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
20974463 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20974515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 22773895 - 22773843
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
22773895 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
22773843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 25631089 - 25631141
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
25631089 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
25631141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 27264112 - 27264164
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
27264112 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27264164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 28394936 - 28394988
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
28394936 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28394988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 28395243 - 28395191
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
28395243 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28395191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 28736750 - 28736698
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
28736750 |
ttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
28736698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 29401399 - 29401347
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
29401399 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29401347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 31172874 - 31172822
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
31172874 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
31172822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 31455885 - 31455937
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||| |||||| |
|
|
| T |
31455885 |
ttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
31455937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 40297668 - 40297720
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
40297668 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
40297720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 40687979 - 40687927
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
40687979 |
ttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
40687927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 40768198 - 40768146
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
40768198 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
40768146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 41880347 - 41880295
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
41880347 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41880295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 8755326 - 8755271
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||| ||||||| |||||| |
|
|
| T |
8755326 |
ggtttaattgcacttttggacccctattttttcaaaagttgtggttatggacccct |
8755271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 19849552 - 19849607
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
19849552 |
ggtttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
19849607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 201
Target Start/End: Complemental strand, 28251691 - 28251644
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
28251691 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttat |
28251644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 28736440 - 28736495
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| | ||| ||||||||||||||||| |||||| |
|
|
| T |
28736440 |
ggtttaattgcacttttggacccctatttttccaaaagttgcggttatggacccct |
28736495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 40297979 - 40297924
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
40297979 |
ggtttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
40297924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 7219501 - 7219551
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| |||| |
|
|
| T |
7219501 |
ttaattgcacttttggacccctattttttcaaaagttgcggttatggaccc |
7219551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 29401093 - 29401143
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
29401093 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
29401143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 30894128 - 30894178
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
30894128 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
30894178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 106 - 144
Target Start/End: Original strand, 41762284 - 41762322
Alignment:
| Q |
106 |
cttaggagtcgggggcttgaaagttgaaacaattggtaa |
144 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41762284 |
cttaggagtcgggggcttgaaagttgaaacaattggtaa |
41762322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 3223594 - 3223549
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
3223594 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
3223549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 9071971 - 9072016
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
9071971 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
9072016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 209
Target Start/End: Original strand, 13356563 - 13356612
Alignment:
| Q |
160 |
attgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
13356563 |
attgcacttttggacccctatctttccaaaagttgcggttatggacccct |
13356612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 15738077 - 15738122
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
15738077 |
ttaattgcactttttgacccctatcttttcaaaagttgcggttatg |
15738122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 16597350 - 16597305
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
16597350 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
16597305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 16666883 - 16666838
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
16666883 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
16666838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 21347742 - 21347697
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
21347742 |
ttaattgcacttttggacccctatcttttcaaaagttacggttatg |
21347697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 28251401 - 28251446
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
28251401 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
28251446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 156 - 201
Target Start/End: Original strand, 33203940 - 33203985
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
33203940 |
tttaattgcaattttggacccctatcttttcaaaagttgcggttat |
33203985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 33825602 - 33825655
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||| ||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
33825602 |
tttaattgcacgtttggacccctatctttccaaaagttgcggttatggacccct |
33825655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 43586096 - 43586051
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
43586096 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
43586051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 38989 - 39037
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| || | ||||||||||||||||||||||| |
|
|
| T |
38989 |
ggtttaattgcacttttggatccatatcttttcaaaagttgcggttatg |
39037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 159 - 207
Target Start/End: Original strand, 1050041 - 1050089
Alignment:
| Q |
159 |
aattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
1050041 |
aattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
1050089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 3738388 - 3738436
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||| ||| | ||||||||||||||||||||| |
|
|
| T |
3738388 |
ggtttaattgcacttttggactcctattttttcaaaagttgcggttatg |
3738436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 4125754 - 4125702
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
4125754 |
ttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
4125702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 5088077 - 5088129
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |||||| |||||| |
|
|
| T |
5088077 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
5088129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 11480039 - 11480091
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
11480039 |
ttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
11480091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 12049122 - 12049174
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
12049122 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
12049174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 13960691 - 13960743
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
13960691 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
13960743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 14647998 - 14647946
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
14647998 |
ttaattgtacttttggacccctatcttttcaaaagtcgcggttatggacccct |
14647946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 16329889 - 16329837
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
16329889 |
ttaattgcacttttggatccctatcttttcaaaagttgtggttatggacccct |
16329837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 16859958 - 16860006
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
16859958 |
ggtttaattgcacttttggacccctatctttttaaaagttgtggttatg |
16860006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 18266355 - 18266407
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| |||||||||||| |||||| |
|
|
| T |
18266355 |
ttaattgcacttttggacccctatctttccaaaggttgcggttatggacccct |
18266407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20974719 - 20974667
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
20974719 |
ttaattgtacttttggacccctatcttttcaaaagttgtggttatggacccct |
20974667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 22052442 - 22052494
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||| ||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
22052442 |
ttaattgcacttttggccccctatctttccaaaagttgcggttatggacccct |
22052494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 22052749 - 22052697
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
22052749 |
ttaattgcaattttggacccctatctttccaaaagttgcggttatggacccct |
22052697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 23103926 - 23103978
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
23103926 |
ttaattacacttttggacccctatctttccaaaagttgcggttatggacccct |
23103978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 28620042 - 28620094
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
28620042 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
28620094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 39528769 - 39528821
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
39528769 |
ttaattgcacttttgaacccctatctttttaaaagttgcggttatggacccct |
39528821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 4096452 - 4096507
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||| ||||| |||||| |
|
|
| T |
4096452 |
ggtttaattgcacttttggacccctatctttctaaaagttgcgtttatggacccct |
4096507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 7623522 - 7623576
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
7623522 |
ggtttaattgcacttttgga-ccctatctttccaaaagttgcggttatggacccct |
7623576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 8340270 - 8340219
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccc |
208 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
8340270 |
ttaattccacttttggacccctatcttttcaaaagttgcgcttatggacccc |
8340219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 202
Target Start/End: Complemental strand, 26036524 - 26036481
Alignment:
| Q |
159 |
aattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
26036524 |
aattgcacttttggacccctatctttccaaaagttgcggttatg |
26036481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 159 - 202
Target Start/End: Complemental strand, 28703957 - 28703914
Alignment:
| Q |
159 |
aattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
28703957 |
aattgcacttttggacccctatctttccaaaagttgcggttatg |
28703914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 156 - 207
Target Start/End: Original strand, 34168789 - 34168840
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||||||||||||||||| ||||| |||||||||||||||| |||| |
|
|
| T |
34168789 |
tttaattgcacttttggacccctatctttcaaaaagttgcggttatggaccc |
34168840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 35678092 - 35678147
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| ||||||||||| ||||| |||||| |
|
|
| T |
35678092 |
ggtttaattgcatttttggacccctatctttccaaaagttgcgattatggacccct |
35678147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 39279 - 39233
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatga |
203 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||| ||||||| |
|
|
| T |
39279 |
ttaattgcacttttggatccctatcttttcaaaagttgcagttatga |
39233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 931850 - 931900
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||| ||||||||| |||| ||||||||||||||||||||||| |||| |
|
|
| T |
931850 |
ttaattgtacttttggatccctatcttttcaaaagttgcggttatggaccc |
931900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 2546682 - 2546637
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
2546682 |
ttaattgcacttttgaacccctatcttttcaaaagttgcagttatg |
2546637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 3223439 - 3223484
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||||| ||||||||||| |
|
|
| T |
3223439 |
ttaattgcacttttggacccctatctattcaaaaattgcggttatg |
3223484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 4096761 - 4096716
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
4096761 |
ttaattgcacttttggacctttatcttttcaaaagttgcggttatg |
4096716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 9072259 - 9072214
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
9072259 |
ttaattgcacttttggacccttatctttccaaaagttgcggttatg |
9072214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 13356860 - 13356807
Alignment:
| Q |
157 |
ttaattgcacttttgga-cccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
13356860 |
ttaattgcacttttggatcccctatctttccaaaagttgcggttatggacccct |
13356807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 13961000 - 13960955
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||| ||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
13961000 |
ttaattgtacttttggacctctatcttttcaaaagttgcggttatg |
13960955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 16079488 - 16079443
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
16079488 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
16079443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 21583633 - 21583588
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
21583633 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
21583588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 23104218 - 23104165
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttctttt-caaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | |||||| ||||||||||||||||| |||||| |
|
|
| T |
23104218 |
ttaattgcacttttggacccttatcttttccaaaagttgcggttatggacccct |
23104165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 26036238 - 26036283
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
26036238 |
ttaattgcacttttggacccatatcttttcaaaagttgtggttatg |
26036283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 29559777 - 29559822
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
29559777 |
ttaattgcacttttggattcctatcttttcaaaagttgcggttatg |
29559822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 32555767 - 32555812
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||| |||||||||||| |||||| |||||||||||||||| |
|
|
| T |
32555767 |
ttaattgcatttttggacccctatctttttaaaagttgcggttatg |
32555812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 32556055 - 32556010
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
32556055 |
ttaattgcacttttggacccatatctttccaaaagttgcggttatg |
32556010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 35055779 - 35055832
Alignment:
| Q |
157 |
ttaattgcacttttgga-cccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
35055779 |
ttaattgcacttttggatcccctatctttccaaaagttgcggttatggacccct |
35055832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 39529075 - 39529030
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
39529075 |
ttaattacacttttggacccctatctttccaaaagttgcggttatg |
39529030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 41032496 - 41032451
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
41032496 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatg |
41032451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 41140424 - 41140379
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
41140424 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatg |
41140379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 42779169 - 42779222
Alignment:
| Q |
157 |
ttaattgcacttttgga-cccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| ||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
42779169 |
ttaattgcacttttggagcccctatctttttaaaagttgcggttatggacccct |
42779222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 1055678 - 1055634
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
1055678 |
ttaattgcacttttggacccctatctttctaaaagttgcggttat |
1055634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 7219807 - 7219755
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| | | ||||| ||||||||||||||||| |||||| |
|
|
| T |
7219807 |
ttaattgcacttttggactcttatctttccaaaagttgcggttatggacccct |
7219755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 8986613 - 8986665
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||| |||||||| |||||| |
|
|
| T |
8986613 |
ttaattgcacttttggactcctatctttccaaaagttacggttatggacccct |
8986665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 9560144 - 9560092
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
9560144 |
ttaattgcatttttggacccctatctttctaaaagttgcggttatgaccccct |
9560092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 10029382 - 10029330
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
10029382 |
ttaattgcacttttgaacccctatctttcgaaaagttgcggttatggacccct |
10029330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 12049427 - 12049383
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||| |||||||||||| ||||| |||||||||||||||| |
|
|
| T |
12049427 |
ttaattgcatttttggacccctatctttccaaaagttgcggttat |
12049383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 13170190 - 13170138
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| |||||||||||||||| |||||| |
|
|
| T |
13170190 |
ttaattgcacttttggacccttatctttctaaaagttgcggttatggacccct |
13170138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 13765571 - 13765519
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| ||||||||||| |||||| |
|
|
| T |
13765571 |
ttaattgcacttttggacccctatctttcaaaaaattgcggttatggacccct |
13765519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 19849853 - 19849801
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||||| ||| |||||| |
|
|
| T |
19849853 |
ttaattgcacttttggacccctatatttccaaaagttgcggtcatggacccct |
19849801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 22627293 - 22627241
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||| |||||||| || |||||| |
|
|
| T |
22627293 |
ttaattgcacttttggatccctatcttttcaaaatttgcggttctggacccct |
22627241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 23263455 - 23263403
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||| ||| ||||||||||||| |||||| |
|
|
| T |
23263455 |
ttaattgcacttttggacctctatctttccaacagttgcggttatggacccct |
23263403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 23502438 - 23502386
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| ||||| |||||| |
|
|
| T |
23502438 |
ttaattgcacttttggacccctatctttccaaaagttgctattatggacccct |
23502386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 30894426 - 30894374
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
30894426 |
ttaattgcatttttggatccctatcttttcaaaagttgtggttatggacccct |
30894374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 42739530 - 42739582
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| ||||||| |||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
42739530 |
ttaattgtacttttgaacccctatcttttcaaaagttgtggttatggacccct |
42739582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 158 - 202
Target Start/End: Original strand, 43585809 - 43585853
Alignment:
| Q |
158 |
taattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
43585809 |
taattgcacttttggacccctatctttctaaaagttgcggttatg |
43585853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 6815503 - 6815542
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
6815503 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
6815542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 159 - 202
Target Start/End: Original strand, 9559859 - 9559902
Alignment:
| Q |
159 |
aattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||| | || ||||||||||||||||||||||| |
|
|
| T |
9559859 |
aattgcacttttggatctctatcttttcaaaagttgcggttatg |
9559902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 16329582 - 16329636
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||| |||||||| | | ||||||||||||||||||||||| |||||| |
|
|
| T |
16329582 |
ggtttaattgcaattttggactc-tatcttttcaaaagttgcggttatggacccct |
16329636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 4146108 - 4146162
Alignment:
| Q |
155 |
gtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||| |||||| ||||| ||||||||||||||||| || || |||||| |
|
|
| T |
4146108 |
gtttaattgcatttttggccccctatcttttcaaaagttgcgattttggacccct |
4146162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Original strand, 10169015 - 10169057
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
||||||||||||||||||| ||||| |||||| |||||||||| |
|
|
| T |
10169015 |
ggtttaattgcacttttggccccctatctttttaaaagttgcg |
10169057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 195
Target Start/End: Complemental strand, 17235315 - 17235277
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgc |
195 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
17235315 |
ttaattgcacttttggtcccctatcttttcaaaagttgc |
17235277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 202
Target Start/End: Complemental strand, 22925948 - 22925902
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| |||| | ||||||||||||| ||||||| |
|
|
| T |
22925948 |
tttaattgcacttttggatccctattttttcaaaagttgtggttatg |
22925902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 200
Target Start/End: Original strand, 38465969 - 38466015
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| |||||||||||||| |
|
|
| T |
38465969 |
ggtttaattgcatttttggacccctatctttctaaaagttgcggtta |
38466015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 3728287 - 3728332
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||| ||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
3728287 |
ttaattgtacttttggacctctatctttccaaaagttgcggttatg |
3728332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 8986920 - 8986868
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgc-ggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| ||||||| |||||| |
|
|
| T |
8986920 |
ttaattgcacttttggacccctatcttttc-aaagttgcgggttatggacccct |
8986868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 195
Target Start/End: Complemental strand, 14514997 - 14514956
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgc |
195 |
Q |
| |
|
||||||||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
14514997 |
ggtttaattgcacttttggccccctatctttccaaaagttgc |
14514956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 16860116 - 16860071
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| | ||| |||||||||||||||| |
|
|
| T |
16860116 |
ttaattgcacttttggacccctatttttctaaaagttgcggttatg |
16860071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 20465506 - 20465551
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||| ||||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
20465506 |
ttaattacacttttggacccctatctttccaaaagttgcagttatg |
20465551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 21583326 - 21583371
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||| ||||| || ||||| ||||||||||||||||| |
|
|
| T |
21583326 |
ttaattgcactttgggacctctatctttccaaaagttgcggttatg |
21583371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 42947404 - 42947449
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
42947404 |
ttaattgcacttttggactcctatctttctaaaagttgcggttatg |
42947449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 3738546 - 3738494
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| | ||||||||| || |||||| |||||||||||||||| |||||| |
|
|
| T |
3738546 |
ttaattgtatttttggacctctatctttttaaaagttgcggttatggacccct |
3738494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 196
Target Start/End: Complemental strand, 8006324 - 8006284
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
8006324 |
tttaattgcacttttggcctcctatcttttcaaaagttgcg |
8006284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 194
Target Start/End: Original strand, 22626985 - 22627025
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttg |
194 |
Q |
| |
|
|||||||||||||||||||||| || ||||| ||||||||| |
|
|
| T |
22626985 |
ggtttaattgcacttttggacctctatctttccaaaagttg |
22627025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 22925702 - 22925746
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||||||||| ||| || ||||| |||||||||||||||| |
|
|
| T |
22925702 |
ttaattgcacttttgaacctctatctttccaaaagttgcggttat |
22925746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 23695529 - 23695581
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | | ||| | ||||||||||||||| |||||| |
|
|
| T |
23695529 |
ttaattgcacttttggacccatatttttcccaaagttgcggttatggacccct |
23695581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 26152102 - 26152050
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||| ||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
26152102 |
ttaattgtacttttagacccatatctttccaaaagttgcggttatggacccct |
26152050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 29560086 - 29560042
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||| || ||||||||| |||||| ||||||||||||||| |
|
|
| T |
29560086 |
ttaattgcatttatggacccctatctttttaaaagttgcggttat |
29560042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182 (Bit Score: 49; Significance: 3e-19; HSPs: 3)
Name: scaffold0182
Description:
Target: scaffold0182; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20598 - 20650
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20598 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
20650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 12047 - 12102
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
12047 |
ggtttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
12102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0182; HSP #3
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 20920 - 20874
Alignment:
| Q |
161 |
ttgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
20920 |
ttgcacttttggacccctatctttccaaaagttgcggttatggaccc |
20874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 49; Significance: 3e-19; HSPs: 151)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 6641908 - 6641856
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
6641908 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatgaacccct |
6641856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 37953686 - 37953631
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
37953686 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37953631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 42363885 - 42363830
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
42363885 |
ggtttaattgcacttttggacccctttctttttaaaagttgcggttatggacccct |
42363830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 44886217 - 44886162
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
44886217 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
44886162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 414965 - 414913
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
414965 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
414913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 2321519 - 2321571
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
2321519 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
2321571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 4167510 - 4167458
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
4167510 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
4167458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 6014422 - 6014474
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
6014422 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
6014474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 17943361 - 17943413
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
17943361 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
17943413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 23234090 - 23234038
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
23234090 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23234038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 37953377 - 37953429
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
37953377 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37953429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 41015104 - 41015056
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
41015104 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
41015056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 45106438 - 45106490
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
45106438 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45106490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 1985882 - 1985827
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
1985882 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1985827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 33881400 - 33881345
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
33881400 |
ggtttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
33881345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 44885904 - 44885959
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
44885904 |
ggtttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
44885959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 4107158 - 4107112
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatga |
203 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
4107158 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatga |
4107112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 6335335 - 6335380
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6335335 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
6335380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 15187931 - 15187976
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15187931 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
15187976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 25249956 - 25250009
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
25249956 |
tttaattgtacttttggacccctatcttttcaaaagttgcggttatggacccct |
25250009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 155 - 204
Target Start/End: Complemental strand, 42930930 - 42930881
Alignment:
| Q |
155 |
gtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaa |
204 |
Q |
| |
|
|||||||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
42930930 |
gtttaattgcactttttgacccctatcttttcaaaagttgcggttatgaa |
42930881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 414670 - 414722
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
414670 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
414722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 994996 - 995048
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
994996 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
995048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 995304 - 995252
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
995304 |
ttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
995252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 1657695 - 1657643
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
1657695 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1657643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 2321827 - 2321775
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
2321827 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatgaacccct |
2321775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 4146788 - 4146840
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
4146788 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
4146840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 5734495 - 5734443
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
5734495 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5734443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 6107427 - 6107375
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
6107427 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6107375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 6335638 - 6335586
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
6335638 |
ttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccct |
6335586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 7151152 - 7151100
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
7151152 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7151100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 8834249 - 8834197
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
8834249 |
ttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
8834197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 14032039 - 14032091
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
14032039 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
14032091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 16531559 - 16531507
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
16531559 |
ttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
16531507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20095689 - 20095741
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
20095689 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20095741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20813739 - 20813791
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
20813739 |
ttaattgcacttgtggacccctatcttttcaaaagttgcggttatggacccct |
20813791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20819755 - 20819807
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
20819755 |
ttaattgcacttttggaccactatcttttcaaaagttgcggttatggacccct |
20819807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 23233784 - 23233828
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
23233784 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttat |
23233828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 27339546 - 27339598
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
27339546 |
ttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
27339598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 30359152 - 30359100
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
30359152 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30359100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 30845870 - 30845818
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
30845870 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30845818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 37205851 - 37205799
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
37205851 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37205799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 38166487 - 38166539
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
38166487 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
38166539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 38166796 - 38166744
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
38166796 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
38166744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 39515561 - 39515613
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
39515561 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
39515613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 40918684 - 40918632
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
40918684 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgaccccct |
40918632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 41625463 - 41625515
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
41625463 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
41625515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 42267459 - 42267511
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
42267459 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
42267511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 42267768 - 42267716
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
42267768 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42267716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 45209286 - 45209234
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
45209286 |
ttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
45209234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 45516230 - 45516178
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
45516230 |
ttaattgcatttttggactcctatcttttcaaaagttgcggttatgaacccct |
45516178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 4147097 - 4147042
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
4147097 |
ggtttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
4147042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 12330073 - 12330128
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
12330073 |
ggtttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
12330128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 14024192 - 14024247
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||| ||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
14024192 |
ggtttaattgcacgtttggacccctatctttacaaaagttgcggttatggacccct |
14024247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 37277773 - 37277718
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||| |||||| |
|
|
| T |
37277773 |
ggtttaattgcacttttggacccctatcttttcaaaagttatggttatggacccct |
37277718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 200
Target Start/End: Complemental strand, 42866403 - 42866360
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
42866403 |
ttaattgcacttttggacccctatcttttcaaaagttgcggtta |
42866360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 45208976 - 45209031
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
45208976 |
ggtttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
45209031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 8287910 - 8287864
Alignment:
| Q |
161 |
ttgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
8287910 |
ttgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
8287864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 8870262 - 8870312
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
8870262 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
8870312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 29233543 - 29233597
Alignment:
| Q |
155 |
gtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| |||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
29233543 |
gtttaattgcacttttggatccctatctttccaaaagttgcggttatgtacccct |
29233597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 32318816 - 32318766
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
32318816 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatgaaccc |
32318766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 38593190 - 38593240
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
38593190 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
38593240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 6107120 - 6107165
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
6107120 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
6107165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 6745304 - 6745263
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggt |
198 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6745304 |
ttaattgcacttttggacccctatcttttcaaaagttgcggt |
6745263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 20095997 - 20095952
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
20095997 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
20095952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 20283985 - 20283940
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
20283985 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
20283940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 20791019 - 20791064
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
20791019 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
20791064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 21070613 - 21070568
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
21070613 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
21070568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 35409713 - 35409762
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatga |
203 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
35409713 |
ggtttaattgcacttttggatccctatctttccaaaagttgcggttatga |
35409762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 39616861 - 39616816
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
39616861 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
39616816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 41206442 - 41206397
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
41206442 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
41206397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 42906684 - 42906639
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
42906684 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
42906639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 4132757 - 4132809
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
4132757 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
4132809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 4133065 - 4133013
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
4133065 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
4133013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 5734187 - 5734239
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| ||||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
5734187 |
ttaattgcatttttgaacccctatcttttcaaaagttgcggttatggacccct |
5734239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 6014728 - 6014676
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| |||||| |||||||||||||||| |||||| |
|
|
| T |
6014728 |
ttaattgcacttttggatccctatctttttaaaagttgcggttatggacccct |
6014676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 6641599 - 6641651
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
6641599 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
6641651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 14024350 - 14024298
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
14024350 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
14024298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 18531143 - 18531091
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| ||||||||||||||| |
|
|
| T |
18531143 |
ttaattgcacttttggacccctatctttctaaaagttacggttatgaacccct |
18531091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 18553281 - 18553229
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
18553281 |
ttaattgcaattttggacccctatctttccaaaagttgcggttatggacccct |
18553229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20814051 - 20813999
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| ||||||||||| |||||| |
|
|
| T |
20814051 |
ttaattgcacttttggacccctatctttccaaaacttgcggttatggacccct |
20813999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 25910281 - 25910333
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||| |||||| |
|
|
| T |
25910281 |
ttaattgcacttttggagtcctttattttcaaaagttgcggttatggacccct |
25910333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 27822878 - 27822930
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| ||||||||||| |||||| |
|
|
| T |
27822878 |
ttaattgcacttttggacccctatctttccaaaatttgcggttatggacccct |
27822930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 28595930 - 28595978
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| ||| || ||||||||||||||||||||||| |
|
|
| T |
28595930 |
ggtttaattgcacttttgaacctctatcttttcaaaagttgcggttatg |
28595978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 29233815 - 29233763
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || |||||| |||||||||||||||| |||||| |
|
|
| T |
29233815 |
ttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
29233763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 31191780 - 31191728
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || |||||| |||||||||||||||| |||||| |
|
|
| T |
31191780 |
ttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
31191728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 32332143 - 32332195
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||| || |||||| |
|
|
| T |
32332143 |
ttaattgcacttttggacccctatctttccaaaagttgcggttttggacccct |
32332195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 36226725 - 36226673
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
36226725 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
36226673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 36788257 - 36788301
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
36788257 |
ttaattgcacttttggacccctatctttccaaaagttgcggttat |
36788301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 36801400 - 36801452
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| || |||||||||||||| |||||| |
|
|
| T |
36801400 |
ttaattgcacttttggacccctatctttccacaagttgcggttatggacccct |
36801452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 37205543 - 37205595
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| ||||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
37205543 |
ttaattgcatttttgaacccctatcttttcaaaagttgcggttatggacccct |
37205595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 39626278 - 39626226
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| |||||||||| |||||| |
|
|
| T |
39626278 |
ttaattgcacttttggacccctatctttccaaaagctgcggttatggacccct |
39626226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 39635828 - 39635776
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||| |||||||||| |||||| |
|
|
| T |
39635828 |
ttaattgcacttttggacccctatctttccaaaagctgcggttatggacccct |
39635776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 42525022 - 42524966
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctt-tcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
42525022 |
ggtttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
42524966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 42642398 - 42642346
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| |||||||||||| |||||| |
|
|
| T |
42642398 |
ttaattgcacttttggacccctatctttccaaaggttgcggttatggacccct |
42642346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 42906375 - 42906427
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
42906375 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
42906427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 45106748 - 45106700
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| |||||| |||||| |||||||||||||||| |
|
|
| T |
45106748 |
ggtttaattgcacttttgaacccctatctttttaaaagttgcggttatg |
45106700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 39625967 - 39626022
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
39625967 |
ggtttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
39626022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 39635517 - 39635572
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
39635517 |
ggtttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
39635572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 41574465 - 41574410
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||| ||||| |||||| |
|
|
| T |
41574465 |
ggtttaattgcacttttggacccctatctttctaaaagttgcgattatggacccct |
41574410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 200
Target Start/End: Complemental strand, 3345687 - 3345641
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
3345687 |
ggtttaattgcacttttggacccctaactttccaaaagttgcggtta |
3345641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 20820062 - 20820012
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
20820062 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatggaccc |
20820012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 27339853 - 27339803
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||| |||||||||||| |||||| |||||||||||||||| |||| |
|
|
| T |
27339853 |
ttaattgcatttttggacccctatctttttaaaagttgcggttatggaccc |
27339803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 30358846 - 30358896
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||| |||| |
|
|
| T |
30358846 |
ttaattgcacttttggacctcgatcttttcaaaagttgcggttatggaccc |
30358896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 199
Target Start/End: Original strand, 37639510 - 37639552
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtt |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |||| |
|
|
| T |
37639510 |
ttaattgcacttttggacccctatcttttcaaaagttgaggtt |
37639552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 16531251 - 16531296
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16531251 |
ttaattgtatttttggacccctatcttttcaaaagttgcggttatg |
16531296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 201
Target Start/End: Complemental strand, 25250257 - 25250212
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||| || ||||| |||||||||||||||| |
|
|
| T |
25250257 |
tttaattgcacttttggacctctatctttccaaaagttgcggttat |
25250212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 30845557 - 30845602
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
30845557 |
ttaattgtacttttggacccctatctttccaaaagttgcggttatg |
30845602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 41206165 - 41206210
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
41206165 |
ttaattgcacttttggacccatatctttccaaaagttgcggttatg |
41206210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 1657391 - 1657443
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
1657391 |
ttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
1657443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 1985572 - 1985624
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| ||||||||||| || ||||||||| ||||||||||||| |||||| |
|
|
| T |
1985572 |
ttaattgtacttttggacctctatcttttcaatagttgcggttatggacccct |
1985624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 7013352 - 7013404
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| || |||| |||||||||||||||||||| || |||||| |
|
|
| T |
7013352 |
ttaattgcacttttagatccctatcttttcaaaagttgcggttttggacccct |
7013404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 7013660 - 7013616
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||||||||||| | || |||||||||||||||||||||| |
|
|
| T |
7013660 |
ttaattgcacttttggatctctatcttttcaaaagttgcggttat |
7013616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 7150845 - 7150897
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| ||||| |||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
7150845 |
ttaattgcatttttgaacccctatcttttcaaaagttgcagttatggacccct |
7150897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 14032343 - 14032291
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
14032343 |
ttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
14032291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20056414 - 20056466
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | |||||| || ||||||||||||| |||||| |
|
|
| T |
20056414 |
ttaattgcacttttggacccttatctttttaatagttgcggttatggacccct |
20056466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20791308 - 20791256
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| ||||||||| || ||||| |||||||||||||||||| ||||| |
|
|
| T |
20791308 |
ttaattgcatttttggacctctatctttccaaaagttgcggttatgaccccct |
20791256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 31190646 - 31190690
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
31190646 |
ttaattgcacttttggacccctatctttctaaaagttgcggttat |
31190690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 35735507 - 35735558
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
35735507 |
ttaattgcacttttggaccc-tatctttccaaaagttgcggttatggacccct |
35735558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 37277463 - 37277515
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||||| | |||| |||||||||||||||| |||||| |
|
|
| T |
37277463 |
ttaattgtacttttggacccctatttttttaaaagttgcggttatggacccct |
37277515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 39515864 - 39515812
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||| ||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
39515864 |
ttaattgtacttttggactcctatctttccaaaagttgcggttatggacccct |
39515812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 41693362 - 41693310
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| || | ||||| ||||||||||||||||||| |||| |
|
|
| T |
41693362 |
ttaattgcacttttggatccttatctttccaaaagttgcggttatgaagccct |
41693310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 41788959 - 41788912
Alignment:
| Q |
157 |
ttaattgcacttttggacccc--tttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
41788959 |
ttaattgcacttttggacccccctatcttttcaaaagttgcggttatg |
41788912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 42363581 - 42363633
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| |||||||||| |||||| |||||| |
|
|
| T |
42363581 |
ttaattgcacttttggacccttatctttccaaaagttgctgttatggacccct |
42363633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 45480354 - 45480310
Alignment:
| Q |
165 |
acttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
45480354 |
acttttggacccctatctttccaaaagttgcggttatggacccct |
45480310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 6655276 - 6655331
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| |||| | | |||| |||||||||||||||| |||||| |
|
|
| T |
6655276 |
ggtttaattgcacttttgaacccatatttttttaaaagttgcggttatggacccct |
6655331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 6735678 - 6735733
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| |||| | | |||| |||||||||||||||| |||||| |
|
|
| T |
6735678 |
ggtttaattgcacttttgaacccatatttttttaaaagttgcggttatggacccct |
6735733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 31947857 - 31947896
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
31947857 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
31947896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 32498381 - 32498420
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
32498381 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
32498420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 200
Target Start/End: Original strand, 43657495 - 43657538
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
43657495 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
43657538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 200
Target Start/End: Complemental strand, 43658491 - 43658448
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
43658491 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
43658448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 8870571 - 8870521
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||| ||||| |||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
8870571 |
ttaattgcatttttgaacccctatctttccaaaagttgcggttatggaccc |
8870521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 209
Target Start/End: Complemental strand, 17943647 - 17943597
Alignment:
| Q |
159 |
aattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||| ||||||||| ||||| |
|
|
| T |
17943647 |
aattgcactttaggacccctatctttccaaaagttacggttatgaccccct |
17943597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 195
Target Start/End: Original strand, 18530835 - 18530873
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgc |
195 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
18530835 |
ttaattgcacttttgaacccctatcttttcaaaagttgc |
18530873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 29454349 - 29454392
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
29454349 |
ttaattgcacttttggacccc--tctttccaaaagttgcggttatg |
29454392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 33877807 - 33877761
Alignment:
| Q |
157 |
ttaattgcacttttggacccctt-tcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||| ||||||| |
|
|
| T |
33877807 |
ttaattgcacttttggaccccctatcttttcaaaagttgtggttatg |
33877761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 159 - 200
Target Start/End: Original strand, 3340071 - 3340112
Alignment:
| Q |
159 |
aattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
3340071 |
aattgcacttttggacccctaactttccaaaagttgcggtta |
3340112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 8833945 - 8833990
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
8833945 |
ttaattgcacttttggacacctatctttcaaaaagttgcggttatg |
8833990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 194
Target Start/End: Complemental strand, 26920026 - 26919989
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttg |
194 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
26920026 |
ttaattgcacttttggccccctatcttttcaaaagttg |
26919989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 27872713 - 27872758
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
27872713 |
ttaattgcacttttggatccctatctttctaaaagttgcggttatg |
27872758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 32693024 - 32692979
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
32693024 |
ttaattgtacttttggacccctatctttccaaaaattgcggttatg |
32692979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 40918396 - 40918441
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||| ||||||||||||||| |||||| ||||||| |||||||| |
|
|
| T |
40918396 |
ttaatttcacttttggacccctatctttttaaaagttacggttatg |
40918441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 41554610 - 41554655
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||| ||||| | ||||||||||||||||||||||| |
|
|
| T |
41554610 |
ttaattgcactttcggacctttatcttttcaaaagttgcggttatg |
41554655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 4167207 - 4167251
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||| ||| | ||||||||||||| |||||| |
|
|
| T |
4167207 |
ttaattgcacttttggacgcctattttttcaaaagttgtggttat |
4167251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 6655588 - 6655536
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| ||||||| |||| ||||| ||||||||||||| ||| |||||| |
|
|
| T |
6655588 |
ttaattgcatttttggatccctatctttccaaaagttgcggtaatggacccct |
6655536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 6735990 - 6735938
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| ||||||| |||| ||||| ||||||||||||| ||| |||||| |
|
|
| T |
6735990 |
ttaattgcatttttggatccctatctttccaaaagttgcggtaatggacccct |
6735938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 28596240 - 28596188
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||||||| ||||||| |||||| |
|
|
| T |
28596240 |
ttaattgcacttttggatccctatctttctaaaagttgtggttatggacccct |
28596188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 33947047 - 33947099
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||||||| | ||||| |||||| |
|
|
| T |
33947047 |
ttaattgtacttttggacccctatctttccaaaagttgagattatggacccct |
33947099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 38593495 - 38593451
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||||||||||||| || | ||| |||||||||||||||| |
|
|
| T |
38593495 |
ttaattgcacttttggacctctatatttccaaaagttgcggttat |
38593451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 41574158 - 41574210
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| ||||||||||| || | ||||||||||||| ||||||| |||||| |
|
|
| T |
41574158 |
ttaattgtacttttggacctctattttttcaaaagttgtggttatggacccct |
41574210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 41788654 - 41788706
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| || ||| |||||| ||||||||| |||||| |||||| |
|
|
| T |
41788654 |
ttaattgcacttttgaactcctatctttttaaaagttgcagttatggacccct |
41788706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: scaffold0283
Description:
Target: scaffold0283; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 1184 - 1239
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
1184 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0283; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 1497 - 1442
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
1497 |
ggtttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
1442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 48; Significance: 1e-18; HSPs: 161)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 35711971 - 35711916
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
35711971 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35711916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 931018 - 930966
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
931018 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
930966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 3925796 - 3925848
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
3925796 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
3925848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 4060991 - 4061043
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4060991 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatgaacccct |
4061043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 10318894 - 10318946
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
10318894 |
ttaattgcacttttggacccctatcttttcaaaagttgcagttatgaacccct |
10318946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 18852498 - 18852550
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
18852498 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
18852550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 19778274 - 19778322
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
19778274 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
19778322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 21917560 - 21917508
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
21917560 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
21917508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 23909898 - 23909950
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
23909898 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23909950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 25986928 - 25986980
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
25986928 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
25986980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 26612653 - 26612601
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
26612653 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
26612601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 34288051 - 34288103
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
34288051 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
34288103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 34533523 - 34533471
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
34533523 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34533471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 35121723 - 35121671
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
35121723 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
35121671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 37047976 - 37047924
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
37047976 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37047924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 37452359 - 37452307
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
37452359 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
37452307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 38445716 - 38445664
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
38445716 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
38445664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 228271 - 228216
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||| || |||||| |
|
|
| T |
228271 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcggttttggacccct |
228216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 18295852 - 18295907
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
18295852 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
18295907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 37047665 - 37047720
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
37047665 |
ggtttaattgcacttttggacccctattttttcaaaagttgcggttatggacccct |
37047720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 10319203 - 10319153
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
10319203 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
10319153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 19778564 - 19778518
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatga |
203 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
19778564 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatga |
19778518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 388211 - 388166
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
388211 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
388166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 30699334 - 30699289
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30699334 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
30699289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 43408514 - 43408469
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
43408514 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
43408469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 930711 - 930763
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
930711 |
ttaattacacttttggacccctatcttttcaaaagttgcggttatggacccct |
930763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 3235426 - 3235374
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
3235426 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
3235374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 5096791 - 5096843
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
5096791 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5096843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 7974701 - 7974649
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
7974701 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7974649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 11900053 - 11900105
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
11900053 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11900105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 11900360 - 11900308
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
11900360 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11900308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 16537080 - 16537132
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
16537080 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
16537132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 16628582 - 16628530
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
16628582 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
16628530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 16879238 - 16879290
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
16879238 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
16879290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 21782606 - 21782658
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
21782606 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
21782658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 23910165 - 23910113
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
23910165 |
ttaattgcacttttggaccactatcttttcaaaagttgcggttatggacccct |
23910113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 25982992 - 25983044
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
25982992 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
25983044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 25987233 - 25987181
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
25987233 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
25987181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 27432493 - 27432545
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
27432493 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27432545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 27512805 - 27512857
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
27512805 |
ttaattgcacttttggacccctatctttacaaaagttgcggttatggacccct |
27512857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 30757227 - 30757279
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
30757227 |
ttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
30757279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 34533217 - 34533269
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| |||||||||||||| |
|
|
| T |
34533217 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatgaacccct |
34533269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 35121416 - 35121468
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
35121416 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
35121468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 35437524 - 35437472
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
35437524 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35437472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 35923895 - 35923947
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
35923895 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35923947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 36376063 - 36376115
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
36376063 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36376115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 36376375 - 36376327
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
36376375 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
36376327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 37996020 - 37996072
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||| |||||| |
|
|
| T |
37996020 |
ttaattgcacttttggacccctatcttttcaaacgttgcggttatggacccct |
37996072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 38053458 - 38053406
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
38053458 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatggacccct |
38053406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 38882373 - 38882425
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| ||||| |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38882373 |
ttaattgcatttttgtacccctatcttttcaaaagttgcggttatgaacccct |
38882425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 39753875 - 39753927
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
39753875 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
39753927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 42997059 - 42997111
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
42997059 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42997111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 44189697 - 44189649
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
44189697 |
ggtttaattgcacttctggacccctatcttttcaaaagttgcggttatg |
44189649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 46622557 - 46622609
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
46622557 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
46622609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 48871401 - 48871353
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
48871401 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
48871353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 227957 - 228012
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
227957 |
ggtttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
228012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 30757537 - 30757482
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| | |||| |||||||||||||||| |||||| |
|
|
| T |
30757537 |
ggtttaattgcacttttggacccctatttttttaaaagttgcggttatggacccct |
30757482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 209
Target Start/End: Complemental strand, 3931806 - 3931752
Alignment:
| Q |
155 |
gtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
3931806 |
gtttaattgcacttttggacccctatctttctaaaagttgcggttatgaccccct |
3931752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 23740267 - 23740317
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
23740267 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
23740317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 27513111 - 27513061
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||| |||| |
|
|
| T |
27513111 |
ttaattgcacttttggacccctatcttttcgaaagttgcggttatggaccc |
27513061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 47732013 - 47731963
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||| |||| |
|
|
| T |
47732013 |
ttaattgcacttttggacccttatcttttcaaaagttgcggttatggaccc |
47731963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 16879548 - 16879503
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
16879548 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
16879503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 18363604 - 18363559
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
18363604 |
ttaattgcacttttggacccctatctttgcaaaagttgcggttatg |
18363559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 18798032 - 18798085
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
18798032 |
tttaattgcacttttggacccctatctttctaaaagttgcggttatgaccccct |
18798085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 19233629 - 19233584
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
19233629 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
19233584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 38882684 - 38882631
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttctttt-caaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
38882684 |
ttaattgcacttttggacccctatcttttccaaaagttgcggttatggacccct |
38882631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 39976732 - 39976777
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
39976732 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
39976777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 44189408 - 44189453
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
44189408 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
44189453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 45231525 - 45231570
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
45231525 |
ttaattgcacttttggacccctatcttttcaaaagttacggttatg |
45231570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 497115 - 497167
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| |||||| |||||| |
|
|
| T |
497115 |
ttaattgcacttttggacccttatcttttcaaaagttgcagttatggacccct |
497167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 3926068 - 3926016
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||||||||| |||||| |
|
|
| T |
3926068 |
ttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
3926016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 3931649 - 3931701
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||| |||||||| ||||| |
|
|
| T |
3931649 |
ttaattgcacttttggacctctatcttttcaaaagttggggttatgaccccct |
3931701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 4061298 - 4061246
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
4061298 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
4061246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 7195456 - 7195504
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||| |||||| |
|
|
| T |
7195456 |
ggtttaattgcatttttggacccctatcttttcaaaagttgcagttatg |
7195504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 9629326 - 9629274
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
9629326 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
9629274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 10312537 - 10312485
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| ||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
10312537 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
10312485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 10350809 - 10350861
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
10350809 |
ttaattgcatttttggacccctatcttttcaaaagttgtggttatggacccct |
10350861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 10351116 - 10351064
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
10351116 |
ttaattgcacttttggaccccaatcttttcaaaagttacggttatggacccct |
10351064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 10385759 - 10385707
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||| |||||| ||||| |
|
|
| T |
10385759 |
ttaattgcacttttggacccctatctttccaaaagttgcgattatgaccccct |
10385707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 11275187 - 11275235
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
11275187 |
ggtttaattgcatttttggacccctatctttccaaaagttgcggttatg |
11275235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 17757773 - 17757825
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
17757773 |
ttaattgcacttttagacccctatctttttaaaagttgcggttatggacccct |
17757825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 18073819 - 18073871
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
18073819 |
ttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
18073871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 18296161 - 18296109
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
18296161 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
18296109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 18852803 - 18852751
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
18852803 |
ttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
18852751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 19194163 - 19194207
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
19194163 |
ttaattgcacttttggacccctatctttccaaaagttgcggttat |
19194207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 19194471 - 19194419
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
19194471 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
19194419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20387860 - 20387808
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| ||||||| |||||| |
|
|
| T |
20387860 |
ttaattgcacttttggacccatatcttttcaaaagttgtggttatggacccct |
20387808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20392334 - 20392282
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| ||||||| |||||| |
|
|
| T |
20392334 |
ttaattgcacttttggacccatatcttttcaaaagttgtggttatggacccct |
20392282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 21917089 - 21917141
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| | ||||||||||||||||||||| |||||| |
|
|
| T |
21917089 |
ttaattgcacttttggatccctattttttcaaaagttgcggttatggacccct |
21917141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 26612345 - 26612397
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
26612345 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
26612397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 30140923 - 30140975
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
30140923 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
30140975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 30141230 - 30141186
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
30141230 |
ttaattgcacttttggacccctatctttgcaaaagttgcggttat |
30141186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 32555611 - 32555559
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
32555611 |
ttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
32555559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 34288361 - 34288309
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
34288361 |
ttaattgcacttttgaacccctatctttttaaaagttgcggttatggacccct |
34288309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 35437209 - 35437261
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
35437209 |
ttaattgcacatttggacccctatctttccaaaagttgcggttatggacccct |
35437261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 35711662 - 35711713
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||||||| |||||| |
|
|
| T |
35711662 |
ttaattgcacttttggacccctatcttttc-aaagttgcggttatggacccct |
35711713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 35924201 - 35924149
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |||||| |||||| |
|
|
| T |
35924201 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
35924149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 38879164 - 38879216
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| ||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
38879164 |
ttaattgtacttttggacctctatcttttcaaaagttgcggttatggacccct |
38879216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 40436039 - 40436091
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
40436039 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatgaccccct |
40436091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 42751252 - 42751200
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | | |||| ||||||||||||||||||||||| |
|
|
| T |
42751252 |
ttaattgcacttttggacccttatttttttaaaagttgcggttatgaacccct |
42751200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 42997362 - 42997318
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
42997362 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttat |
42997318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 44214662 - 44214714
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
44214662 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
44214714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 45231830 - 45231778
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |||||| |||||| |
|
|
| T |
45231830 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
45231778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 47731705 - 47731757
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||| ||||||||||| |||||| |
|
|
| T |
47731705 |
ttaattgcacttttggacccctatcttttaaaaaattgcggttatggacccct |
47731757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 49081646 - 49081598
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| || |||| ||||||||||||||||||||||| |
|
|
| T |
49081646 |
ggtttaattgcacttttagatccctatcttttcaaaagttgcggttatg |
49081598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 5181744 - 5181689
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |||| |||||| |||||| |
|
|
| T |
5181744 |
ggtttaattgcacttttagacccctatcttttcaaaaattgcagttatggacccct |
5181689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 201
Target Start/End: Complemental strand, 18798323 - 18798276
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| |||||||||||||||| |
|
|
| T |
18798323 |
ggtttaattgcacttttggatccctatctttccaaaagttgcggttat |
18798276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 156 - 202
Target Start/End: Original strand, 10986002 - 10986048
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
10986002 |
tttaattgcacttttagacctctatcttttcaaaagttgcggttatg |
10986048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 26872670 - 26872624
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatga |
203 |
Q |
| |
|
|||||| ||||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
26872670 |
ttaattccacttttggacccttatcttttcaaaagttgcggttatga |
26872624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 36204495 - 36204453
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
36204495 |
ggtttaattgcacttttggccccctatcttttcaaaagttgcg |
36204453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 9035361 - 9035406
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||| |||||||||||| |||||| |||||||||||||||| |
|
|
| T |
9035361 |
ttaattgcaattttggacccctatctttttaaaagttgcggttatg |
9035406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 10356408 - 10356363
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
10356408 |
ttaattgcacttttggacccctatatttccaaaagttgcggttatg |
10356363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 11275475 - 11275430
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||| ||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11275475 |
ttaattacacctttggacccctatcttttcaaaagttgcggttatg |
11275430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 18074125 - 18074080
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
18074125 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
18074080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 19233343 - 19233388
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
19233343 |
ttaattgcacttttggaaccctatctttccaaaagttgcggttatg |
19233388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 25036035 - 25036080
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
25036035 |
ttaattgcactttttgacccctatattttcaaaagttgcggttatg |
25036080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 30401218 - 30401173
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||| ||||||| |
|
|
| T |
30401218 |
ttaattgcacttttggactcctatcttttcaaaagttgtggttatg |
30401173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 38879460 - 38879415
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||| |||| |
|
|
| T |
38879460 |
ttaattgcacttttggacccctatctttccaaaagttgcggctatg |
38879415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 209
Target Start/End: Complemental strand, 39754185 - 39754132
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||| ||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
39754185 |
tttatttgcatttttggacccctatctttccaaaagttgcggttatggacccct |
39754132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 43632344 - 43632389
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
43632344 |
ttaattgcacttttggacccctatctttccaaaaattgcggttatg |
43632389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 5097095 - 5097043
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
5097095 |
ttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
5097043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 7974392 - 7974444
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| | ||| ||||||||||||||||| |||||| |
|
|
| T |
7974392 |
ttaattgcacttttgaacccctatttttccaaaagttgcggttatggacccct |
7974444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 9035672 - 9035620
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| ||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
9035672 |
ttaattgcacttttggattcctatctttccaaaagttgcggttatggacccct |
9035620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 11742968 - 11742916
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| || ||| ||||| |
|
|
| T |
11742968 |
ttaattgcacttttggccccctatcttttcaaaagttgcgattttgatcccct |
11742916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 18363298 - 18363350
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||| ||||| |||||| |
|
|
| T |
18363298 |
ttaattgcacttttggacccctatgtttccaaaagttgcgattatggacccct |
18363350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20387556 - 20387608
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| |||||||||| |||||| |||||| |
|
|
| T |
20387556 |
ttaattgcacttttggacccttatctttccaaaagttgcagttatggacccct |
20387608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20392030 - 20392082
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| |||||||||| |||||| |||||| |
|
|
| T |
20392030 |
ttaattgcacttttggacccttatctttccaaaagttgcagttatggacccct |
20392082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 23740575 - 23740523
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
23740575 |
ttaattgtacttttggacccctatctttcgaaaagttgcggttatggacccct |
23740523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 24775935 - 24775883
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||| | ||||||||| ||||||| |||||| |
|
|
| T |
24775935 |
ttaattgcacttttggacccctatctctccaaaagttgtggttatggacccct |
24775883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 205
Target Start/End: Complemental strand, 25036343 - 25036295
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaac |
205 |
Q |
| |
|
||||||||||||||||| |||| |||||| |||||||| |||||||||| |
|
|
| T |
25036343 |
ttaattgcacttttggatccctatctttttaaaagttgtggttatgaac |
25036295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 25983301 - 25983249
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||| || || |||||| |||||||||||||||| |||||| |
|
|
| T |
25983301 |
ttaattgcacttttgggcctctatctttttaaaagttgcggttatggacccct |
25983249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 30699026 - 30699078
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||||||||| |||||| |||||| |
|
|
| T |
30699026 |
ttaattgcacttttggatccctatctttccaaaagttgcagttatggacccct |
30699078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 34404446 - 34404498
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||||| ||||||||||| |||||| |
|
|
| T |
34404446 |
ttaattgcacttttagacccctatctttccaaaaattgcggttatggacccct |
34404498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 194
Target Start/End: Complemental strand, 36801914 - 36801874
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttg |
194 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
36801914 |
ggtttaattgcacttttggccccctatcttttcaaaagttg |
36801874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 37996325 - 37996269
Alignment:
| Q |
154 |
ggtttaattgcacttttgga-cccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||| ||||||| ||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
37996325 |
ggtttaattgcatttttggatcccctatctttccaaaagttgcggttatggacccct |
37996269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 200
Target Start/End: Original strand, 10715841 - 10715884
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
10715841 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
10715884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 11578055 - 11578110
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||| |||||||||||||| || || |||||||||||||||| |||||| |
|
|
| T |
11578055 |
ggtttaattgtacttttggacccctatcattcaaaaagttgcggttatggacccct |
11578110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Complemental strand, 18201694 - 18201655
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
18201694 |
ttaattgcacttttggccccctgtcttttcaaaagttgcg |
18201655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 155 - 202
Target Start/End: Complemental strand, 30028695 - 30028648
Alignment:
| Q |
155 |
gtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||||||||| ||||||| |
|
|
| T |
30028695 |
gtttaattgcacttttggactcttatcttttcaaaagttgtggttatg |
30028648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 200
Target Start/End: Original strand, 30085624 - 30085667
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
30085624 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
30085667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 200
Target Start/End: Complemental strand, 30086613 - 30086570
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
30086613 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
30086570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 38445404 - 38445459
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| |||||||| ||||||| |||||| |
|
|
| T |
38445404 |
ggtttaattgcacttttggatccctatctttcaaaaagttgtggttatggacccct |
38445459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Complemental strand, 45480139 - 45480100
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
45480139 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
45480100 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 21202915 - 21202873
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
||||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
21202915 |
ggtttaattgcacttttggccccctatctttccaaaagttgcg |
21202873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Original strand, 48925911 - 48925953
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
||||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
48925911 |
ggtttaattgcactttttgtcccctatcttttcaaaagttgcg |
48925953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 9629015 - 9629060
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||| ||||||||||| ||| |||||| |||||||||||||||| |
|
|
| T |
9629015 |
ttaattacacttttggactcctatctttttaaaagttgcggttatg |
9629060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 11578366 - 11578321
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||| |||||||||||||| ||||| |||| |||||||||||| |
|
|
| T |
11578366 |
ttaattgtacttttggacccctatctttccaaaggttgcggttatg |
11578321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 16537387 - 16537342
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
16537387 |
ttaattgcacttttggacccctgtctttcgaaaagttgtggttatg |
16537342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 16628275 - 16628320
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| ||||||| |
|
|
| T |
16628275 |
ttaattgcacttttggacccctgtctttcgaaaagttgtggttatg |
16628320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 21782914 - 21782861
Alignment:
| Q |
157 |
ttaattgcacttttgga-cccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| ||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
21782914 |
ttaattgcacttttggaccccctatctttccaaaagttgtggttatggacccct |
21782861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 30028397 - 30028442
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
30028397 |
ttaattgcactttaggacccctatctttctaaaagttgcggttatg |
30028442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 37452054 - 37452099
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||| || || | ||||||||||||||||||||||| |
|
|
| T |
37452054 |
ttaattgcacttttagatccatatcttttcaaaagttgcggttatg |
37452099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 194
Target Start/End: Complemental strand, 39142500 - 39142463
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttg |
194 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
39142500 |
ttaattgcacttttggtcccctatcttttcaaaagttg |
39142463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 43408227 - 43408272
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||| |||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
43408227 |
ttaatttcacttttggacctctatctttccaaaagttgcggttatg |
43408272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 16705746 - 16705702
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
16705746 |
ttaattgcatttttggacctttatcttttcaaaagttgcggttat |
16705702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 17679982 - 17679938
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
17679982 |
ttaattgcatttttggacctttatcttttcaaaagttgcggttat |
17679938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Complemental strand, 25683985 - 25683949
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagtt |
193 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
25683985 |
ttaattgcacttttggacccctatctttccaaaagtt |
25683949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 34404745 - 34404693
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||| |||||||||| |||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
34404745 |
ttaagtgcacttttgaacccttatctttccaaaagttgcggttatggacccct |
34404693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 194
Target Start/End: Original strand, 38974410 - 38974450
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttg |
194 |
Q |
| |
|
|||||||||||| |||||| ||||| ||||||||||||||| |
|
|
| T |
38974410 |
ggtttaattgcatttttggccccctatcttttcaaaagttg |
38974450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 39977038 - 39976986
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| || |||||||| || |||||||||| |||| |
|
|
| T |
39977038 |
ttaattgcatttttggacccctatcctttcaaaaattacggttatgaatccct |
39976986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 46622863 - 46622811
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| |||||| ||||| |||| |||||||||||| |||||| |
|
|
| T |
46622863 |
ttaattgcacttttcaacccctatctttccaaaggttgcggttatggacccct |
46622811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 1e-18; HSPs: 104)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 9703857 - 9703802
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
9703857 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
9703802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 11277930 - 11277877
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11277930 |
ggtttaattgtacttttggacccctatcttttcaaaagttgcggttatgaaccc |
11277877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 1814979 - 1815031
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
1814979 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1815031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 3535092 - 3535044
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3535092 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
3535044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 10977661 - 10977713
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
10977661 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
10977713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 11322335 - 11322283
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
11322335 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11322283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 15273292 - 15273244
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
15273292 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
15273244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 31741081 - 31741029
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
31741081 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
31741029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 205
Target Start/End: Original strand, 31833269 - 31833317
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaac |
205 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
31833269 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatgaac |
31833317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 11445976 - 11446031
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
11445976 |
ggtttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
11446031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 158 - 209
Target Start/End: Original strand, 12256768 - 12256819
Alignment:
| Q |
158 |
taattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
12256768 |
taattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
12256819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 15150041 - 15149986
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
15150041 |
ggtttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
15149986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 2565081 - 2565126
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2565081 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
2565126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 2565389 - 2565344
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2565389 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
2565344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 3195719 - 3195764
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
3195719 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
3195764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 10977971 - 10977918
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
10977971 |
ggtttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
10977918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 11746289 - 11746244
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11746289 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
11746244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 2100691 - 2100639
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
2100691 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
2100639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 3185467 - 3185415
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
3185467 |
ttaattgcacttttggtcccctatcttttcaaaagttgcggttatggacccct |
3185415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 4405551 - 4405499
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
4405551 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
4405499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 5606299 - 5606351
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
5606299 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
5606351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 5606607 - 5606555
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
5606607 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
5606555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 6261384 - 6261436
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
6261384 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6261436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 6261687 - 6261635
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
6261687 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6261635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 7391488 - 7391540
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
7391488 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7391540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 11213493 - 11213441
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
11213493 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11213441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 13042411 - 13042463
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
13042411 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
13042463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 23291259 - 23291311
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
23291259 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23291311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 23883092 - 23883144
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||| |||||| |
|
|
| T |
23883092 |
ttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
23883144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 27765261 - 27765313
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
27765261 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27765313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 28930774 - 28930730
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28930774 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttat |
28930730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 29696851 - 29696903
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
29696851 |
ttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
29696903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 30965694 - 30965746
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
30965694 |
ttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
30965746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 31740772 - 31740824
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
31740772 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
31740824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 17965839 - 17965894
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
17965839 |
ggtttaattgcacttttggatccctatcttttcaaaagttggggttatggacccct |
17965894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 28930467 - 28930517
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||| |||| |
|
|
| T |
28930467 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggaccc |
28930517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 160 - 202
Target Start/End: Original strand, 30818224 - 30818266
Alignment:
| Q |
160 |
attgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
30818224 |
attgcacttttggacccctatcttttcaaaagttgcggttatg |
30818266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 154 - 208
Target Start/End: Original strand, 31951205 - 31951259
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccc |
208 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| |||||||||||||||| ||||| |
|
|
| T |
31951205 |
ggtttaattgcatttttggacccctatctttttaaaagttgcggttatggacccc |
31951259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 10893892 - 10893937
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
10893892 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
10893937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 11746001 - 11746046
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
11746001 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
11746046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 13042718 - 13042673
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
13042718 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
13042673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 15149730 - 15149775
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
15149730 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatg |
15149775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 15273001 - 15273046
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
15273001 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
15273046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 20080121 - 20080166
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
20080121 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
20080166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 25749958 - 25750003
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
25749958 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
25750003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 26716681 - 26716636
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
26716681 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
26716636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 31951511 - 31951466
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
31951511 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
31951466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 1815286 - 1815234
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
1815286 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
1815234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 1896901 - 1896945
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
1896901 |
ttaattgcacttttggacccctatctttccaaaagttgcggttat |
1896945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 2100383 - 2100435
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||||| |||| |
|
|
| T |
2100383 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatgaatccct |
2100435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 7391787 - 7391735
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
7391787 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
7391735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 11277629 - 11277673
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
11277629 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttat |
11277673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 11614901 - 11614953
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
11614901 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
11614953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 14997012 - 14997064
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
14997012 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
14997064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 14997319 - 14997275
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
14997319 |
ttaattgcacttttggacccctatctttgcaaaagttgcggttat |
14997275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 15711946 - 15711894
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
15711946 |
ttaattgcacttttcgacccctatctttttaaaagttgcggttatggacccct |
15711894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 16765044 - 16765096
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
16765044 |
ttaattgtacttttggacccctatctttccaaaagttgcggttatgcacccct |
16765096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 18683015 - 18683067
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||| ||||||| |||||| |
|
|
| T |
18683015 |
ttaattgcacttttggacctctatcttttcaaaagttgtggttatggacccct |
18683067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 22279502 - 22279554
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| ||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
22279502 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
22279554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 23883398 - 23883346
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
23883398 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
23883346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 27223619 - 27223567
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
27223619 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
27223567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 29697153 - 29697101
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |||||| |||||| |
|
|
| T |
29697153 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
29697101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 30818525 - 30818473
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| | |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
30818525 |
ttaattgcacttttgaatccctatcttttcaaaagttgcggttatggacccct |
30818473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 30966002 - 30965950
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
30966002 |
ttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
30965950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 31833576 - 31833524
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| ||||||||||| |||||| |
|
|
| T |
31833576 |
ttaattgcacttttggacccctatctttccaaaaattgcggttatggacccct |
31833524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 201
Target Start/End: Original strand, 7324655 - 7324702
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||| ||||||| |||| |||||||||||||||||||||| |
|
|
| T |
7324655 |
ggtttaattgcatttttggatccctatcttttcaaaagttgcggttat |
7324702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 9067745 - 9067690
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | | |||||||||||||||||||||||| ||||| |
|
|
| T |
9067745 |
ggtttaattgcacttttggattcttatcttttcaaaagttgcggttatgaccccct |
9067690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 201
Target Start/End: Complemental strand, 10255833 - 10255786
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
10255833 |
ggtttaattgcacttttggacccctatctttttaaaagttgcagttat |
10255786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 15711637 - 15711683
Alignment:
| Q |
157 |
ttaattgcacttttggacc-cctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
15711637 |
ttaattgcacttttggacctcctatcttttcaaaagttgcggttatg |
15711683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 16735875 - 16735825
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||||||||| |||| |
|
|
| T |
16735875 |
ttaattgcacttttggacccctatttttccaaaagttgcggttatggaccc |
16735825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 3534801 - 3534846
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
3534801 |
ttaattacacttttggacccctatctttccaaaagttgcggttatg |
3534846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 10894180 - 10894135
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
10894180 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatg |
10894135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 22279808 - 22279763
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||| ||||||||||| |
|
|
| T |
22279808 |
ttaattgcacttttgaacccctatcttttcaaaaattgcggttatg |
22279763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 34705686 - 34705641
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
34705686 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatg |
34705641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 1897189 - 1897137
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| ||||| |||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
1897189 |
ttaattgcatttttgaacccctatctttccaaaagttgcggttatgaccccct |
1897137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 11321905 - 11321957
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| | |||| |||||||| ||||||| |||||| |
|
|
| T |
11321905 |
ttaattgcacttttggacccctatttttttaaaagttgtggttatggacccct |
11321957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 11615209 - 11615157
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||| |||| |||||| |||||||||||||||| |||||| |
|
|
| T |
11615209 |
ttaattgcacttttgggtccctatctttttaaaagttgcggttatggacccct |
11615157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 12257074 - 12257022
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
12257074 |
ttaattgcacttttggacctttatctttccaaaagttgcggttatggacccct |
12257022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 17966148 - 17966096
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||| | |||| |||||||||||||||||||||| |
|
|
| T |
17966148 |
ttaattgcacttttggaccccctatctttccaaagttgcggttatgaacccct |
17966096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 18683320 - 18683268
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| ||||||||||||||| | ||| ||||||||||||||||| |||||| |
|
|
| T |
18683320 |
ttaatttcacttttggacccctatttttccaaaagttgcggttatggacccct |
18683268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 20630355 - 20630399
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||| ||||||||| ||||| |||||||||||||||| |
|
|
| T |
20630355 |
ttaattgcacttatggacccctatctttccaaaagttgcggttat |
20630399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20630659 - 20630607
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| |||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
20630659 |
ttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20630607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 21003371 - 21003423
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| | |||||| |
|
|
| T |
21003371 |
ttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
21003423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 27771524 - 27771472
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| ||||||||||||| | |||||| |||||||||||||||| |||||| |
|
|
| T |
27771524 |
ttaattacacttttggacccttatctttttaaaagttgcggttatggacccct |
27771472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 28563330 - 28563382
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||| |||||| |
|
|
| T |
28563330 |
ttaattgcacttttggacccctacctttctaaaagttgcggttatggacccct |
28563382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 28563630 - 28563578
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||| |||||||||||||||| |||||| |
|
|
| T |
28563630 |
ttaattgcacttttggacctctatctttcaaaaagttgcggttatggacccct |
28563578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 30239514 - 30239462
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||| |||||||||| |||||| |||||| |
|
|
| T |
30239514 |
ttaattgcacttttagacccctatctttccaaaagttgcagttatggacccct |
30239462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 3185233 - 3185288
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||| ||||||||||| |||||||| ||||| ||||||||| |||||||| ||||| |
|
|
| T |
3185233 |
ggttaaattgcactttaggacccctatctttccaaaagttgaggttatgaccccct |
3185288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 4037041 - 4037080
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
4037041 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
4037080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 200
Target Start/End: Original strand, 28931952 - 28931995
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
28931952 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
28931995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 200
Target Start/End: Complemental strand, 28932947 - 28932904
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
28932947 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
28932904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 3196022 - 3195972
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||||||||||| || | ||||||||||||||| ||||||| |||| |
|
|
| T |
3196022 |
ttaattgcacttttggatccttatcttttcaaaagttgtggttatggaccc |
3195972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 195
Target Start/End: Original strand, 6324205 - 6324243
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgc |
195 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
6324205 |
ttaattgcacttttggccccctatcttttcaaaagttgc |
6324243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 199
Target Start/End: Original strand, 34705379 - 34705421
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtt |
199 |
Q |
| |
|
||||||||| |||||||||||| | |||||||||||||||||| |
|
|
| T |
34705379 |
ttaattgcatttttggacccctatattttcaaaagttgcggtt |
34705421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 20080409 - 20080364
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||| |||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
20080409 |
ttaattgtacttttggacccctatctttgtaaaagttgcggttatg |
20080364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 194
Target Start/End: Complemental strand, 23585288 - 23585251
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttg |
194 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
23585288 |
ttaattgcacttttggacccctatctttccaaaagttg |
23585251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 26171517 - 26171472
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| ||||| ||||| |
|
|
| T |
26171517 |
ttaattgcacttttggacccctatctttccaaaacttgcgattatg |
26171472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 199
Target Start/End: Complemental strand, 28772075 - 28772030
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggtt |
199 |
Q |
| |
|
||||| ||||||||||||| ||||| |||||||||| ||||||||| |
|
|
| T |
28772075 |
ggtttgattgcacttttggccccctatcttttcaaacgttgcggtt |
28772030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 13439880 - 13439932
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| || ||| ||||| ||||||||||| ||||| |||||| |
|
|
| T |
13439880 |
ttaattgcacttttgaactcctatctttccaaaagttgcgtttatggacccct |
13439932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 13440186 - 13440134
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| | | ||||| ||||||||||||||| | |||||| |
|
|
| T |
13440186 |
ttaattgcacttttggactcttatctttccaaaagttgcggttacggacccct |
13440134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 14169028 - 14168976
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||| ||||| || ||| ||||| |
|
|
| T |
14169028 |
ttaattgcacttttggccccctatcttttcaaaatttgcgattttgaccccct |
14168976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 16765347 - 16765296
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||| ||||||| |||||| |
|
|
| T |
16765347 |
ttaattgcacttttggacccctatctttac-aaagttgaggttatggacccct |
16765296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 21008730 - 21008782
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||| |||| | ||||||||||||||| |||||||||||||| |
|
|
| T |
21008730 |
ttaattgcatttttagacctttatcttttcaaaagttgtggttatgaacccct |
21008782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Original strand, 33274235 - 33274271
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagtt |
193 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
33274235 |
ttaattgcacttttggccccctatcttttcaaaagtt |
33274271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 170)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 40355848 - 40355903
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
40355848 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40355903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 52149519 - 52149572
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
52149519 |
tttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52149572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 6491419 - 6491471
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
6491419 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatgaacccct |
6491471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 6491726 - 6491674
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
6491726 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
6491674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 11018712 - 11018660
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
11018712 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11018660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 13791885 - 13791833
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
13791885 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
13791833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 16490977 - 16491029
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16490977 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatgaacccct |
16491029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 21727925 - 21727873
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
21727925 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
21727873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 22204308 - 22204360
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
22204308 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22204360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 23341967 - 23342019
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
23341967 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
23342019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 32341802 - 32341750
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
32341802 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
32341750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 38622713 - 38622661
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
38622713 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
38622661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 45884951 - 45885003
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
45884951 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45885003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 52143475 - 52143423
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
52143475 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52143423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 52149824 - 52149772
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
52149824 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
52149772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 9517559 - 9517504
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
9517559 |
ggtttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
9517504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 11204812 - 11204757
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
11204812 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11204757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 158 - 209
Target Start/End: Complemental strand, 29795003 - 29794952
Alignment:
| Q |
158 |
taattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
29795003 |
taattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
29794952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 32558212 - 32558267
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
32558212 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
32558267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 49227120 - 49227175
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
49227120 |
ggtttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
49227175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 52143165 - 52143220
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
52143165 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52143220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 8770466 - 8770516
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
8770466 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
8770516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 22071163 - 22071216
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
22071163 |
ggtttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
22071216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 39427414 - 39427459
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39427414 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
39427459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 14743 - 14795
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
14743 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
14795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 2371487 - 2371435
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
2371487 |
ttaattgcacttttggacccctatcttttaaaaagttgcggttatggacccct |
2371435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 6183292 - 6183240
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| | |||||| |
|
|
| T |
6183292 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttaaggacccct |
6183240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 6809071 - 6809123
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
6809071 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
6809123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 8028963 - 8029015
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
8028963 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
8029015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 8774301 - 8774353
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
8774301 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
8774353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 9058169 - 9058221
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
9058169 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
9058221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 9517253 - 9517305
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
9517253 |
ttaattgctcttttggacccctatcttttcaaaagttgcggttatggacccct |
9517305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 11018404 - 11018456
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
11018404 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11018456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 11052207 - 11052155
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
11052207 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11052155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 11204510 - 11204562
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
11204510 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11204562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 15161608 - 15161556
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
15161608 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
15161556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20224386 - 20224334
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
20224386 |
ttaattgtacttttggacccctatcttttcaaaagttgcggttatggacccct |
20224334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20596173 - 20596121
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
20596173 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
20596121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 22075661 - 22075617
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22075661 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttat |
22075617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 23342271 - 23342219
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
23342271 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23342219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 23356696 - 23356748
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
23356696 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23356748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 158 - 202
Target Start/End: Complemental strand, 23357003 - 23356959
Alignment:
| Q |
158 |
taattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23357003 |
taattgcacttttggacccctatcttttcaaaagttgcggttatg |
23356959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 26435000 - 26434948
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
26435000 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgaccccct |
26434948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 26861277 - 26861329
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
26861277 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
26861329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 28503446 - 28503394
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
28503446 |
ttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
28503394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 32341498 - 32341550
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
32341498 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
32341550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 34988101 - 34988145
Alignment:
| Q |
165 |
acttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
34988101 |
acttttggacccctatcttttcaaaagttgcggttatgaacccct |
34988145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 36230552 - 36230600
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
36230552 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
36230600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 37028931 - 37028983
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
37028931 |
ttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
37028983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 42406886 - 42406938
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
42406886 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
42406938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 42407195 - 42407143
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
42407195 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42407143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 43677106 - 43677158
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||||||||||||||||||||||| |
|
|
| T |
43677106 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatgaacccct |
43677158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 43677411 - 43677360
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
43677411 |
ttaattgcacttttggaccc-tatcttttcaaaagttgcggttatgaacccct |
43677360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 43914890 - 43914838
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
43914890 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
43914838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 44846921 - 44846973
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
44846921 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
44846973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 45680094 - 45680146
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
45680094 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
45680146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 45885259 - 45885207
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
45885259 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
45885207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 47113391 - 47113443
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
47113391 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47113443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 47113697 - 47113645
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||| |||||| |
|
|
| T |
47113697 |
ttaattgcacttttggacccctatcttttcaaaatttgcggttatggacccct |
47113645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 8535829 - 8535774
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
8535829 |
ggtttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8535774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 8601068 - 8601013
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
8601068 |
ggtttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8601013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 19830424 - 19830369
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
19830424 |
ggtttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
19830369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 36139366 - 36139421
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
36139366 |
ggtttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
36139421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 209
Target Start/End: Complemental strand, 6809381 - 6809327
Alignment:
| Q |
155 |
gtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
6809381 |
gtttaattgcatttttggacccctatcttttcaaaagttgtggttatggacccct |
6809327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 7598916 - 7598866
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
7598916 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggaccc |
7598866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 25098440 - 25098390
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
25098440 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
25098390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 203
Target Start/End: Original strand, 27855566 - 27855612
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatga |
203 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
27855566 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatga |
27855612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 922473 - 922428
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
922473 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
922428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 6182985 - 6183030
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
6182985 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
6183030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 9053713 - 9053660
Alignment:
| Q |
157 |
ttaattgcacttttggacccctt-tcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||||||||| |||||| |
|
|
| T |
9053713 |
ttaattgcacttttggaccccctatcttttcaaaagttgcggttatggacccct |
9053660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 9332903 - 9332956
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||| | || ||||||||||||||||||||||| |||| |
|
|
| T |
9332903 |
ggtttaattgcacttttggagctctatcttttcaaaagttgcggttatggaccc |
9332956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 207
Target Start/End: Original strand, 9356676 - 9356729
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||| | || ||||||||||||||||||||||| |||| |
|
|
| T |
9356676 |
ggtttaattgcacttttggagctctatcttttcaaaagttgcggttatggaccc |
9356729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 20224081 - 20224126
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
20224081 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatg |
20224126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 206
Target Start/End: Original strand, 21727615 - 21727664
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacc |
206 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||||||| |
|
|
| T |
21727615 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatgaacc |
21727664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 23793092 - 23793047
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
23793092 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
23793047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 27396836 - 27396791
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
27396836 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
27396791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 160 - 209
Target Start/End: Complemental strand, 36139664 - 36139615
Alignment:
| Q |
160 |
attgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
36139664 |
attgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36139615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 40815176 - 40815131
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
40815176 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatg |
40815131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 43914581 - 43914626
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
43914581 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
43914626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 45664450 - 45664405
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
45664450 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
45664405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 46320679 - 46320724
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
46320679 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatg |
46320724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 52233434 - 52233479
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
52233434 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
52233479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 2371180 - 2371232
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
2371180 |
ttaattgcacttttggacccctatctttcaaaaagttgcggttatggacccct |
2371232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 2372722 - 2372670
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
2372722 |
ttaattgcaattttggacccctatctttttaaaagttgcggttatggacccct |
2372670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 2383349 - 2383401
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
2383349 |
ttaattgcaattttggacccctatctttttaaaagttgcggttatggacccct |
2383401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 3264003 - 3264055
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| |||||||| |||||| |
|
|
| T |
3264003 |
ttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
3264055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 3383967 - 3384011
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
3383967 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttat |
3384011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 7598612 - 7598664
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
7598612 |
ttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
7598664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 8774607 - 8774555
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| |||||||||| ||||||||||||| |
|
|
| T |
8774607 |
ttaattgcacttttggacccttatctttccaaaagttgcagttatgaacccct |
8774555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 11051899 - 11051943
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
11051899 |
ttaattgcacttttggacccctatctttccaaaagttgcggttat |
11051943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 12690024 - 12690076
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
12690024 |
ttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
12690076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 13098034 - 13098086
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
13098034 |
ttaattgcacttttggatccctatcttttaaaaagttgcggttatgaccccct |
13098086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 14460304 - 14460356
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |||||| |||||| |
|
|
| T |
14460304 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
14460356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 15161300 - 15161352
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
15161300 |
ttaattgcacttttggacccatatctttccaaaagttgcggttatggacccct |
15161352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20287770 - 20287822
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
20287770 |
ttaattgcacttttggaaccctacctttccaaaagttgcggttatgaacccct |
20287822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 20359311 - 20359263
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
20359311 |
ggtttaattgcatttttggacccctatctttccaaaagttgcggttatg |
20359263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 20551659 - 20551707
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
20551659 |
ggtttaattgcatttttggacccctatctttccaaaagttgcggttatg |
20551707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 29704620 - 29704664
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
29704620 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttat |
29704664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 29794696 - 29794748
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |||||| |||||| |
|
|
| T |
29794696 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
29794748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 30288179 - 30288231
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| || |||||||||||||| |||||| |
|
|
| T |
30288179 |
ttaattgcacttttggacccctatctttccagaagttgcggttatggacccct |
30288231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 30288509 - 30288457
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| | || |||||| ||||||||||||||||||||||| |
|
|
| T |
30288509 |
ttaattgcacttttggatctctatcttttaaaaagttgcggttatgaacccct |
30288457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 34988396 - 34988344
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
34988396 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
34988344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 37029238 - 37029186
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
37029238 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
37029186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 39427723 - 39427671
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
39427723 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
39427671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 41585595 - 41585543
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || |||||| |||||||||||||||| |||||| |
|
|
| T |
41585595 |
ttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
41585543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 45012635 - 45012679
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
45012635 |
ttaattgcacttttggacccctatctttccaaaagttgcggttat |
45012679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 45664159 - 45664207
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||| |||||||||||| |||||| |||||||||||||||| |
|
|
| T |
45664159 |
ggtttaattgcatttttggacccctatctttttaaaagttgcggttatg |
45664207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 46320986 - 46320934
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
46320986 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
46320934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 47764094 - 47764146
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || | ||||||||||||||||||||| |||||| |
|
|
| T |
47764094 |
ttaattgcacttttggacctctattttttcaaaagttgcggttatggacccct |
47764146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 52363489 - 52363437
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||| ||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
52363489 |
ttaattgcattttttgacccctatctttccaaaagttgcggttatgaacccct |
52363437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 202
Target Start/End: Complemental strand, 1480557 - 1480510
Alignment:
| Q |
155 |
gtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| |||||| ||||| ||||||||||||||||| |
|
|
| T |
1480557 |
gtttaattgcacttttgtacccctatctttccaaaagttgcggttatg |
1480510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 4243130 - 4243185
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
4243130 |
ggtttaattgtacttttggacccctatctttctaaaagttgcggttatggacccct |
4243185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 13791576 - 13791631
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||| |||||||||| ||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
13791576 |
ggtttaattgtacttttggactcctatctttccaaaagttgcggttatggacccct |
13791631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 14460615 - 14460560
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||| |||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
14460615 |
ggtttaattgtacttttggacccctatctttctaaaagttgcggttatggacccct |
14460560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 26434709 - 26434764
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| |||||||| ||||||||| ||||| |
|
|
| T |
26434709 |
ggtttaattgcacttttgaacccctatctttccaaaagttacggttatgaccccct |
26434764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 31797067 - 31797118
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccc |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| ||||||||||| ||||| |
|
|
| T |
31797067 |
ttaattgcacttttggacccctatctttccaaaaattgcggttatggacccc |
31797118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 158 - 209
Target Start/End: Complemental strand, 40356158 - 40356107
Alignment:
| Q |
158 |
taattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||||| ||||||| |||||| |
|
|
| T |
40356158 |
taattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
40356107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 45680403 - 45680348
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| ||||||||||||| |||| | ||||||||||||||||||||| |||||| |
|
|
| T |
45680403 |
ggtttagttgcacttttggatccctattttttcaaaagttgcggttatggacccct |
45680348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 8770773 - 8770723
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||||||||| |||| |
|
|
| T |
8770773 |
ttaattgcacttttggacccctatttttccaaaagttgcggttatggaccc |
8770723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 4243437 - 4243392
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| |||| |||||| |||||||||||||||| |
|
|
| T |
4243437 |
ttaattgcacttttggatccctatctttttaaaagttgcggttatg |
4243392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 10279987 - 10279942
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
10279987 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatg |
10279942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 16491285 - 16491240
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
16491285 |
ttaattgcacttttggacctttatcttttcaaaagttgcggttatg |
16491240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 18589852 - 18589897
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
18589852 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatg |
18589897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 20017687 - 20017642
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
20017687 |
ttaattgcacttttggacccctatctttccaaaagttgcgtttatg |
20017642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 22204616 - 22204571
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
22204616 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatg |
22204571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 30294873 - 30294918
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
30294873 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatg |
30294918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 38622406 - 38622451
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||||| |||||| |
|
|
| T |
38622406 |
ttaattgcacttttggacccctatcttttcagaagttgcagttatg |
38622451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 40618733 - 40618778
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
40618733 |
ttaattgcacttttggacccctatatttccaaaagttgcggttatg |
40618778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 49056126 - 49056179
Alignment:
| Q |
157 |
ttaattgcacttttggacccctt-tcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
49056126 |
ttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
49056179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 49056433 - 49056380
Alignment:
| Q |
157 |
ttaattgcacttttggacccctt-tcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
49056433 |
ttaattgcacttttggaccccctatctttccaaaagttgcggttatggacccct |
49056380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 921756 - 921808
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| |||||||| ||| || ||||| |||||||||||||||||||||||| |
|
|
| T |
921756 |
ttaattacacttttgaacctctatctttccaaaagttgcggttatgaacccct |
921808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20471417 - 20471469
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| |||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
20471417 |
ttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20471469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20471722 - 20471670
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| ||||| |||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
20471722 |
ttaattgcatttttgaacccctatctttccaaaagttgcggttatggacccct |
20471670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20559815 - 20559867
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| ||||| |||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
20559815 |
ttaattgcatttttgaacccctatctttccaaaagttgcggttatggacccct |
20559867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20560120 - 20560068
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| |||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
20560120 |
ttaattgcacttttagacctctatctttccaaaagttgcggttatggacccct |
20560068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 23208319 - 23208363
Alignment:
| Q |
165 |
acttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
23208319 |
acttttggactcctatcttttcaaaagttgcggttatggacccct |
23208363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 28503138 - 28503190
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| ||||||| |||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
28503138 |
ttaattacacttttagacctctatcttttcaaaagttgcggttatggacccct |
28503190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 49227426 - 49227374
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||| ||||||||| |||||| |
|
|
| T |
49227426 |
ttaattgcacttttggacccctaactttccaaaagtcgcggttatggacccct |
49227374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 15911675 - 15911714
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
15911675 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
15911714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 200
Target Start/End: Original strand, 25820113 - 25820156
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
25820113 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
25820156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 200
Target Start/End: Complemental strand, 25820863 - 25820820
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
25820863 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
25820820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 193
Target Start/End: Original strand, 46038900 - 46038939
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagtt |
193 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
46038900 |
ggtttaattgcacttttggccccctatcttttcaaaagtt |
46038939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 6912494 - 6912452
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
||||||||||||||||||| ||||| |||||| |||||||||| |
|
|
| T |
6912494 |
ggtttaattgcacttttggccccctatcttttgaaaagttgcg |
6912452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 195
Target Start/End: Complemental strand, 7764491 - 7764453
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgc |
195 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
7764491 |
ttaattgcacttttggccccctatcttttcaaaagttgc |
7764453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 13344489 - 13344447
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
||||||||||||||||||| ||||| | ||||||||||||||| |
|
|
| T |
13344489 |
ggtttaattgcacttttggccccctattttttcaaaagttgcg |
13344447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 202
Target Start/End: Original strand, 32037845 - 32037891
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||| |||||||||||| | ||||||||||||| ||||||| |
|
|
| T |
32037845 |
tttaattgcatttttggacccctattttttcaaaagttgtggttatg |
32037891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 195
Target Start/End: Complemental strand, 46351533 - 46351495
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgc |
195 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
46351533 |
ttaattgcacttttggtcccctatcttttcaaaagttgc |
46351495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 160 - 202
Target Start/End: Complemental strand, 47764398 - 47764356
Alignment:
| Q |
160 |
attgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||| ||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
47764398 |
attgtacttttgaacccctatcttttcaaaagttgcggttatg |
47764356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 8029267 - 8029222
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||||||||| |||||| |
|
|
| T |
8029267 |
ttaattgcacttttggatccctatctttccaaaagttgcagttatg |
8029222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 12071647 - 12071692
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||| ||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
12071647 |
ttaattacacttttggacccctatctttcaaaaagttgcggttatg |
12071692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 18590140 - 18590095
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| |||| |||||| |||||||| ||||||| |
|
|
| T |
18590140 |
ttaattgcacttttggatccctatctttttaaaagttgtggttatg |
18590095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 23792783 - 23792828
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||| ||||||||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
23792783 |
ttaattacacttttggacacctatctttccaaaagttgcggttatg |
23792828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 155 - 196
Target Start/End: Complemental strand, 26932925 - 26932884
Alignment:
| Q |
155 |
gtttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| ||||||||||| |
|
|
| T |
26932925 |
gtttaattgcacttttggccccctatctttccaaaagttgcg |
26932884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 30289457 - 30289412
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| | ||||| |||||||| |||||||| |
|
|
| T |
30289457 |
ttaattgcacttttggacccatatctttccaaaagttacggttatg |
30289412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 33811735 - 33811694
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggt |
198 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||| |
|
|
| T |
33811735 |
ttaattgcatttttggacccctatctttccaaaagttgcggt |
33811694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 33871205 - 33871164
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggt |
198 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||| |
|
|
| T |
33871205 |
ttaattgcatttttggacccctatctttccaaaagttgcggt |
33871164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 40814890 - 40814934
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
40814890 |
ttaattgcacttttgga-ccctatctttccaaaagttgcggttatg |
40814934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 41585288 - 41585333
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||| ||||||| | || ||||||||||||||||||||||| |
|
|
| T |
41585288 |
ttaattgcatttttggatctctatcttttcaaaagttgcggttatg |
41585333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 42589423 - 42589468
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
42589423 |
ttaattgcacttttggacttctatctttacaaaagttgcggttatg |
42589468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 42589711 - 42589667
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||| ||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
42589711 |
ttaattacacttttggacccctatcttttc-aaagttgcggttatg |
42589667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 43670624 - 43670579
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||| ||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
43670624 |
ttaattgcacatttggacccctatatttccaaaagttgcggttatg |
43670579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 52233722 - 52233677
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||| ||||||| |||| | ||||||||||||||||||||| |
|
|
| T |
52233722 |
ttaattgcatttttggatccctatattttcaaaagttgcggttatg |
52233677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 6912220 - 6912263
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
6912220 |
ttaattgcacttttgg-cccctatcttttcaaaagttgcgattat |
6912263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 12071955 - 12071911
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||||||||||| | || ||||| |||||||||||||||| |
|
|
| T |
12071955 |
ttaattgcacttttggatctctatctttccaaaagttgcggttat |
12071911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 19830117 - 19830169
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||| |||| |||||| |
|
|
| T |
19830117 |
ttaattgcacttttggacccttatctttcaaaaagttgcggctatggacccct |
19830169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 201
Target Start/End: Original strand, 20017381 - 20017429
Alignment:
| Q |
154 |
ggtttaattgcacttttgga-cccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| |||||||| ||||||| |
|
|
| T |
20017381 |
ggtttaattgcacttttggaccccctatctttccaaaagttacggttat |
20017429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 23208608 - 23208564
Alignment:
| Q |
165 |
acttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||| ||||||||||||||| | |||||| |
|
|
| T |
23208608 |
acttttggacccctatctttccaaaagttgcggttacggacccct |
23208564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 30295180 - 30295136
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| |||||| |
|
|
| T |
30295180 |
ttaattgcacttttggacccctatctttctaaaagttgtggttat |
30295136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 51272680 - 51272732
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| ||||||| ||| || ||||||| ||||||||||||||| |||||| |
|
|
| T |
51272680 |
ttaattgtacttttgaacctctatcttttcgaaagttgcggttatggacccct |
51272732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 51272988 - 51272936
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||| | ||||| |||||||||||||||| |||||| |
|
|
| T |
51272988 |
ttaattgcacttttagacccttatctttcaaaaagttgcggttatggacccct |
51272936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 2e-17; HSPs: 179)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 29168731 - 29168784
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
29168731 |
tttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
29168784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 8727916 - 8727968
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
8727916 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
8727968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 9079803 - 9079855
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
9079803 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
9079855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 9630771 - 9630823
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
9630771 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatgaacccct |
9630823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 19914479 - 19914531
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
19914479 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
19914531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 25126308 - 25126256
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
25126308 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
25126256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 31117623 - 31117675
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
31117623 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31117675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 33576719 - 33576667
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
33576719 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
33576667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 41282157 - 41282105
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
41282157 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
41282105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 45760543 - 45760491
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
45760543 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45760491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 47943770 - 47943718
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
47943770 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
47943718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 51843112 - 51843060
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
51843112 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
51843060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 201
Target Start/End: Original strand, 9792921 - 9792968
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9792921 |
ggtttaattgcacttttgaacccctttcttttcaaaagttgcggttat |
9792968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 33252798 - 33252743
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
33252798 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
33252743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 53422089 - 53422144
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
53422089 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53422144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 2119024 - 2118979
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
2119024 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
2118979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 17483868 - 17483823
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
17483868 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
17483823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 27719996 - 27719951
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27719996 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
27719951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 32205157 - 32205112
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32205157 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
32205112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 52613632 - 52613587
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
52613632 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
52613587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 787102 - 787154
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
787102 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
787154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 2118716 - 2118768
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
2118716 |
ttaattgcacttttagacccctatcttttcaaaagttgcggttatggacccct |
2118768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 2239230 - 2239282
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
2239230 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
2239282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 2239540 - 2239488
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
2239540 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
2239488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 3212462 - 3212410
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
3212462 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
3212410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 8313952 - 8314004
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
8313952 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
8314004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 10864118 - 10864170
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
10864118 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
10864170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 10864429 - 10864377
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| ||||||||||||| |
|
|
| T |
10864429 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatgaacccct |
10864377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 17483564 - 17483616
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
17483564 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
17483616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 17916393 - 17916341
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
17916393 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
17916341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 19391641 - 19391693
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
19391641 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19391693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 19392013 - 19391961
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
19392013 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19391961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 19914782 - 19914730
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
19914782 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19914730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 22202487 - 22202539
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
22202487 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
22202539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 27748553 - 27748501
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
27748553 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27748501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 27766521 - 27766573
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
27766521 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27766573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 27766827 - 27766775
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
27766827 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27766775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 27857445 - 27857393
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
27857445 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27857393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 28097420 - 28097472
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
28097420 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
28097472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 28097734 - 28097682
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
28097734 |
ttaattccacttttggacccctatcttttcaaaagttgcggttatggacccct |
28097682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 28964156 - 28964208
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
28964156 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
28964208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 30200419 - 30200471
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
30200419 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
30200471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 30761110 - 30761058
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
30761110 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatggacccct |
30761058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 33621869 - 33621921
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
33621869 |
ttaattgcacttttggacccctatctttacaaaagttgcggttatggacccct |
33621921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 33622176 - 33622124
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
33622176 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
33622124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 37182007 - 37182059
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
37182007 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37182059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 38511967 - 38511923
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38511967 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttat |
38511923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 40082215 - 40082267
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
40082215 |
ttaattgcacttttggacacctatcttttcaaaagttgcggttatgatcccct |
40082267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 41223516 - 41223560
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41223516 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttat |
41223560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 42230341 - 42230289
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
42230341 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42230289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 44177291 - 44177343
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
44177291 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44177343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 44183975 - 44184027
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
44183975 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44184027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 44184281 - 44184229
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
44184281 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44184229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 44624536 - 44624484
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
44624536 |
ttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
44624484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 44895958 - 44895906
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
44895958 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
44895906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 45743902 - 45743954
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
45743902 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
45743954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 47423147 - 47423195
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
47423147 |
ggtttaattgcacttttggacccttatcttttcaaaagttgcggttatg |
47423195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 47530342 - 47530394
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
47530342 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47530394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 47530650 - 47530598
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
47530650 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
47530598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 47943462 - 47943514
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
47943462 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
47943514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 49997966 - 49997914
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
49997966 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
49997914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 50033551 - 50033499
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||| |||||| |
|
|
| T |
50033551 |
ttaattgcacttttggacccctatcttttcaaaggttgcggttatggacccct |
50033499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 51336893 - 51336945
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
51336893 |
ttaattgcacttttggactcctatcttttcaaaagttgcggttatgaccccct |
51336945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 52916862 - 52916914
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
52916862 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52916914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 53192117 - 53192169
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
53192117 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53192169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 53531809 - 53531861
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| | |||||| |
|
|
| T |
53531809 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttaaggacccct |
53531861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 53532116 - 53532064
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
53532116 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
53532064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 200
Target Start/End: Original strand, 9153480 - 9153523
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9153480 |
ttaattgcacttttggacccctatcttttcaaaagttgcggtta |
9153523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 10439593 - 10439538
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||| |||||||||| | ||||||||||||||||||||||| |||||| |
|
|
| T |
10439593 |
ggtttaattgcatttttggacccttatcttttcaaaagttgcggttatggacccct |
10439538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 33576407 - 33576462
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
33576407 |
ggtttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
33576462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 51213310 - 51213361
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccc |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||| ||||| |
|
|
| T |
51213310 |
ttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccc |
51213361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 159 - 209
Target Start/End: Original strand, 3212158 - 3212208
Alignment:
| Q |
159 |
aattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
3212158 |
aattgcacttttggacccctatctttctaaaagttgcggttatgaacccct |
3212208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 32507930 - 32507980
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| |||| |
|
|
| T |
32507930 |
ttaattgcacttttggacccctattttttcaaaagttgcggttatggaccc |
32507980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 36373855 - 36373805
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||| |
|
|
| T |
36373855 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggaccc |
36373805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 38511662 - 38511712
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||| |
|
|
| T |
38511662 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggaccc |
38511712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 257440 - 257493
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||| | |||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
257440 |
tttaattgtatttttggactcctatcttttcaaaagttgcggttatgaacccct |
257493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 12881238 - 12881283
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
12881238 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
12881283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 12881525 - 12881480
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
12881525 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
12881480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 20982569 - 20982524
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
20982569 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
20982524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 25053894 - 25053849
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
25053894 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
25053849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 26494688 - 26494733
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
26494688 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
26494733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 27748247 - 27748292
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
27748247 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
27748292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 27984142 - 27984187
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||| |
|
|
| T |
27984142 |
ttaattgcacttttggacccctatctttttaaaagttgcggttatg |
27984187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 34942737 - 34942786
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatga |
203 |
Q |
| |
|
|||||||||| |||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
34942737 |
ggtttaattgtacttttggactcctatcttttcaaaagttgcggttatga |
34942786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 42465694 - 42465739
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
42465694 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
42465739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 47423438 - 47423393
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
47423438 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
47423393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 53190964 - 53191009
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
53190964 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
53191009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 53192423 - 53192378
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
53192423 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
53192378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 257746 - 257694
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
257746 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
257694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 2711704 - 2711756
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
2711704 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatgaccccct |
2711756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 5576936 - 5576988
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
5576936 |
ttaattgtacttttggacccctatctttttaaaagttgcggttatgcacccct |
5576988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 5577243 - 5577191
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
5577243 |
ttaattgcacttttggacccctatctttccaaaagttgaggttatggacccct |
5577191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 7857984 - 7858036
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||||| |||||||||||||||||| ||||| ||||| |
|
|
| T |
7857984 |
ttaattgtacttttggacccctatcttttcaaaagttgcggctatgaccccct |
7858036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 9633708 - 9633656
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
9633708 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
9633656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 11961868 - 11961920
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| | |||||| |
|
|
| T |
11961868 |
ttaattgcacttttggacccctaacttttcaaaagttgcggttacggacccct |
11961920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 22202796 - 22202748
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||| |||||||| |
|
|
| T |
22202796 |
ggtttaattgcacttttggatccctatcttttcaaaagttacggttatg |
22202748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 25782656 - 25782708
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| | ||| |||||||||||||||||||||||| |
|
|
| T |
25782656 |
ttaattgcactttttgacccctatttttccaaaagttgcggttatgaacccct |
25782708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 26012981 - 26012933
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
26012981 |
ggtttaattgcatttttggactcctatcttttcaaaagttgcggttatg |
26012933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 28964464 - 28964412
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
28964464 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
28964412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 31869505 - 31869453
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||| || |||||| |
|
|
| T |
31869505 |
ttaattgcacttttggacccctatctttccaaaagttgcggttttggacccct |
31869453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 32508229 - 32508177
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
32508229 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
32508177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 32593790 - 32593838
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| || |||||| |||||||||||||||| |
|
|
| T |
32593790 |
ggtttaattgcacttttggacctctatcttttaaaaagttgcggttatg |
32593838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 36441634 - 36441582
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| | |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
36441634 |
ttaattgcacttttgaatccctatcttttcaaaagttgcggttatggacccct |
36441582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 39905731 - 39905783
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| |||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
39905731 |
ttaattgcactttttgacctctatcttttcaaaagttgcggttatgaccccct |
39905783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 41223823 - 41223771
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| ||||||| |||||| |
|
|
| T |
41223823 |
ttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
41223771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 41281848 - 41281900
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
41281848 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
41281900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 41722057 - 41722109
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||||||||| |||||| |
|
|
| T |
41722057 |
ttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
41722109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 43679012 - 43678960
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| ||| | |||||||||||||||||||||| ||||| |
|
|
| T |
43679012 |
ttaattgcacttttggacacctatattttcaaaagttgcggttatgaccccct |
43678960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 44895652 - 44895704
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||| ||||| |||||| |
|
|
| T |
44895652 |
ttaattgcacttttggacccctatctttttaaaagttgcgattatggacccct |
44895704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 47722149 - 47722197
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| ||||||||||||||||| |
|
|
| T |
47722149 |
ggtttaattgcacttttgaacccctatctttccaaaagttgcggttatg |
47722197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 49859761 - 49859709
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| ||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
49859761 |
ttaattgtacttttggacctctatcttttcaaaagttgcggttatgatcccct |
49859709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 51214469 - 51214417
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || |||||| |||||||||||||||| |||||| |
|
|
| T |
51214469 |
ttaattgcacttttggacctctatctttttaaaagttgcggttatggacccct |
51214417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 2205537 - 2205592
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
2205537 |
ggtttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
2205592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 5153781 - 5153836
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| || |||||| ||||||| |||||||| |||||| |
|
|
| T |
5153781 |
ggtttaattgcacttttggacctctatctttttaaaagttacggttatggacccct |
5153836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 155 - 202
Target Start/End: Original strand, 48160484 - 48160531
Alignment:
| Q |
155 |
gtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
48160484 |
gtttaattgcatatttggacccctatcttttcaaaagttgcggttatg |
48160531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 40082500 - 40082454
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatga |
203 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
40082500 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatga |
40082454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 41722294 - 41722244
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||| ||||||| |||| |
|
|
| T |
41722294 |
ttaattgcacttttgaacccctatcttttcaaaagttgtggttatggaccc |
41722244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 3384298 - 3384253
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||||||||||| |
|
|
| T |
3384298 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatg |
3384253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 7858272 - 7858227
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
7858272 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatg |
7858227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 165 - 202
Target Start/End: Complemental strand, 14015445 - 14015408
Alignment:
| Q |
165 |
acttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
14015445 |
acttttggacccctatcttttcaaaagttgcggttatg |
14015408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 20982283 - 20982328
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
20982283 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatg |
20982328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 21841730 - 21841775
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |
|
|
| T |
21841730 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatg |
21841775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 21842021 - 21841976
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||| |||| || ||||||||||||||||||||||| |
|
|
| T |
21842021 |
ttaattgcacttttagacctctatcttttcaaaagttgcggttatg |
21841976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 24636353 - 24636398
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
24636353 |
ttaattgtacttttggacccctatcttttcaaaagttgtggttatg |
24636398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 27984442 - 27984397
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
27984442 |
ttaattacacttttggacccctatctttccaaaagttgcggttatg |
27984397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 31577730 - 31577685
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| ||||||| |
|
|
| T |
31577730 |
ttaattgcacttttggacccctatctttttaaaagttgtggttatg |
31577685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 42230036 - 42230081
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
42230036 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatg |
42230081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 49859525 - 49859574
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatga |
203 |
Q |
| |
|
||||||||||||||||||||| ||| ||||| ||||||||||||||||| |
|
|
| T |
49859525 |
ggtttaattgcacttttggactcctatctttctaaaagttgcggttatga |
49859574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 49997658 - 49997703
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
49997658 |
ttaattgcacttttggacccctatttttccaaaagttgcggttatg |
49997703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 52917629 - 52917584
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||| ||||| ||||| ||||||||||||||||| |
|
|
| T |
52917629 |
ttaattgcacttttgggcccctatctttccaaaagttgcggttatg |
52917584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 53191273 - 53191228
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
53191273 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatg |
53191228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 787410 - 787358
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| | ||| ||||||||||||||||| |||||| |
|
|
| T |
787410 |
ttaattgcacttttggatccctatttttccaaaagttgcggttatggacccct |
787358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 2205838 - 2205794
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||| |||||||||| |
|
|
| T |
2205838 |
ttaattgcacttttggacccctatctttccaaaaattgcggttat |
2205794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 7818933 - 7818981
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| |||||||||||||||| |
|
|
| T |
7818933 |
ggtttaattgcacttttgaacccctatctttctaaaagttgcggttatg |
7818981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 8315391 - 8315347
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||||||||| |||||| | |||||||||||||||||||| |
|
|
| T |
8315391 |
ttaattgcacttttgaacccctattttttcaaaagttgcggttat |
8315347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 11963035 - 11962983
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| | |||||| |
|
|
| T |
11963035 |
ttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
11962983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 29169038 - 29168986
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
29169038 |
ttaattgcacttttagacatctatcttttcaaaagttgcggttatggacccct |
29168986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 30200724 - 30200672
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||| ||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
30200724 |
ttaattgcacttttagactcctatctttccaaaagttgcggttatggacccct |
30200672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 32204851 - 32204903
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||| ||||| |||||| |
|
|
| T |
32204851 |
ttaattgcacttttggacctctatctttccaaaagttgcgcttatggacccct |
32204903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 32594082 - 32594034
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||| ||||||||||| || ||||||||||||||| ||||||| |
|
|
| T |
32594082 |
ggtttaattgtacttttggacctctatcttttcaaaagttgtggttatg |
32594034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 36017071 - 36017019
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| ||||||| ||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
36017071 |
ttaatttcacttttagacccctatctttccaaaagttgcggttatgcacccct |
36017019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 37182309 - 37182257
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||| || ||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
37182309 |
ttaattgcggttatggacccctatcttttcaaaagttgcggttatggacccct |
37182257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 44177595 - 44177543
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
44177595 |
ttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
44177543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 45744209 - 45744157
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| | || ||||| ||||||||||||||||| |||||| |
|
|
| T |
45744209 |
ttaattgcacttttggatctctatctttccaaaagttgcggttatggacccct |
45744157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 45760235 - 45760287
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| |||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
45760235 |
ttaattgcactttttgacctctatctttccaaaagttgcggttatggacccct |
45760287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 51842804 - 51842856
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| || | || ||||||||||||||||||||||| |||||| |
|
|
| T |
51842804 |
ttaattgcacttttagatctctatcttttcaaaagttgcggttatggacccct |
51842856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 5049661 - 5049618
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctt-tcttttcaaaagttgcg |
196 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||| |
|
|
| T |
5049661 |
ggtttaattgcacttttggcccccttatcttttcaaaagttgcg |
5049618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 193
Target Start/End: Complemental strand, 8728225 - 8728186
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagtt |
193 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
8728225 |
ggtttaattgcacttttggacccctatctttccaaaagtt |
8728186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 193
Target Start/End: Complemental strand, 9080112 - 9080073
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagtt |
193 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
9080112 |
ggtttaattgcacttttggacccctatctttccaaaagtt |
9080073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 31577420 - 31577474
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| |||||| |||||| |||| ||||||||||| |||||| |
|
|
| T |
31577420 |
ggtttaattgcacttttg-acccctatctttttaaaaattgcggttatggacccct |
31577474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 201
Target Start/End: Original strand, 32458779 - 32458826
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
32458779 |
ggtttaattgcatttttggactcctatctttccaaaagttgcggttat |
32458826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 46934042 - 46934081
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
46934042 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
46934081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 51860641 - 51860586
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||| || ||| ||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
51860641 |
ggtttaattgtacctttagacccctatctttttaaaagttgcggttatggacccct |
51860586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 200
Target Start/End: Original strand, 54717168 - 54717211
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
54717168 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
54717211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 200
Target Start/End: Complemental strand, 54718158 - 54718115
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
54718158 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
54718115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 9793229 - 9793179
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||| | | ||||||||||| ||||||||||| |||| |
|
|
| T |
9793229 |
ttaattgcacttttggactcttatcttttcaaaaattgcggttatggaccc |
9793179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 24394002 - 24393952
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||||||||||| ||| ||||||||||||||| ||||||| |||| |
|
|
| T |
24394002 |
ttaattgcacttttggattcctatcttttcaaaagttgtggttatggaccc |
24393952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 24636651 - 24636601
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||| ||||||||| || | ||||||||||||||||||||||| |||| |
|
|
| T |
24636651 |
ttaattgtacttttggatccttatcttttcaaaagttgcggttatggaccc |
24636601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 202
Target Start/End: Original strand, 25053605 - 25053651
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| || | | ||||||||||||||||||||| |
|
|
| T |
25053605 |
tttaattgcacttttggatccttattttttcaaaagttgcggttatg |
25053651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 199
Target Start/End: Original strand, 44701818 - 44701860
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtt |
199 |
Q |
| |
|
|||||||||||||||| ||||| ||||| |||||||||||||| |
|
|
| T |
44701818 |
ttaattgcacttttggccccctatctttccaaaagttgcggtt |
44701860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 51860337 - 51860386
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||| |||||||||||| ||||||| ||||||||||||||| |||| |
|
|
| T |
51860337 |
ttaattgcatttttggacccctatcttttc-aaagttgcggttatggaccc |
51860386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 5154091 - 5154046
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||| || | ||| ||||||||||||||||| |
|
|
| T |
5154091 |
ttaattgcacttttggaccactatttttccaaaagttgcggttatg |
5154046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 24393693 - 24393746
Alignment:
| Q |
157 |
ttaattgcacttttgga-cccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| ||||| |||||| |||||||| ||||||| |||||| |
|
|
| T |
24393693 |
ttaattgcacttttggaccccctatctttttaaaagttgtggttatggacccct |
24393746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 27448817 - 27448862
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||| ||||||| |||||| ||||| ||||||||||||||||| |
|
|
| T |
27448817 |
ttaattgtacttttgaacccctatctttccaaaagttgcggttatg |
27448862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 36441485 - 36441530
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
36441485 |
ttaattgcacttttggactcctatctttctaaaagttgcggttatg |
36441530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 46934298 - 46934253
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||| ||||| ||||| ||||||||||| ||||| |
|
|
| T |
46934298 |
ttaattgcacttttggccccctatctttccaaaagttgcgattatg |
46934253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 47722460 - 47722415
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||| | |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
47722460 |
ttaattgtatttttggactcctatcttttcaaaagttgcggttatg |
47722415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 194
Target Start/End: Original strand, 54716479 - 54716516
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttg |
194 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
54716479 |
ttaattgcacttttggccccctatcttttcaaaagttg |
54716516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 9153787 - 9153735
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| ||| ||||| ||||||| |||||||| |||||| |
|
|
| T |
9153787 |
ttaattgcacttttggactcctatctttctaaaagttacggttatggacccct |
9153735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 9588424 - 9588372
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||| ||| | |||||||||||||||| ||||| |||||| |
|
|
| T |
9588424 |
ttaattgcacttttgggcccttatcttttcaaaagttgcatttatggacccct |
9588372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 10439289 - 10439341
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || | |||| |||||||| ||||||| |||||| |
|
|
| T |
10439289 |
ttaattgcacttttggacctctatttttttaaaagttgtggttatggacccct |
10439341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Complemental strand, 14004144 - 14004108
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagtt |
193 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
14004144 |
ttaattgcacttttggatccctatcttttcaaaagtt |
14004108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 25782963 - 25782911
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||| | | ||||| ||||||||||||||||| |||||| |
|
|
| T |
25782963 |
ttaattgcacttttagacacttatctttccaaaagttgcggttatggacccct |
25782911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 194
Target Start/End: Complemental strand, 30632437 - 30632397
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttg |
194 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
30632437 |
ggtttaattgcacttttgatcccctatcttttcaaaagttg |
30632397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 32459093 - 32459041
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| ||||||| | || ||||| ||||||||||||||||| |||||| |
|
|
| T |
32459093 |
ttaattgcatttttggatctctatctttccaaaagttgcggttatggacccct |
32459041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 33252487 - 33252539
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||||| ||||| |||||||||| ||||| |||||| |
|
|
| T |
33252487 |
ttaattgtacttttggacccctatctttctaaaagttgcgattatggacccct |
33252539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 33933678 - 33933634
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||| |||||| ||||| ||||| |||||||||||||||| |
|
|
| T |
33933678 |
ttaattgcaattttggccccctatctttccaaaagttgcggttat |
33933634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 42465980 - 42465928
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| ||| | ||||| |||||||||||||||||| ||||| |
|
|
| T |
42465980 |
ttaattgcacttttgaacctcaatctttccaaaagttgcggttatgatcccct |
42465928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 53422390 - 53422342
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||| ||||||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
53422390 |
ggtttaattacacttttagacccctatctttctaaaagttgcggttatg |
53422342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594 (Bit Score: 45; Significance: 8e-17; HSPs: 2)
Name: scaffold0594
Description:
Target: scaffold0594; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 5595 - 5647
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
5595 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
5647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0594; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 5903 - 5851
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
5903 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
5851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 45; Significance: 8e-17; HSPs: 3)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 79297 - 79245
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
79297 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
79245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 12968 - 12923
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
12968 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatg |
12923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 78993 - 79038
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |
|
|
| T |
78993 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatg |
79038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 45; Significance: 8e-17; HSPs: 181)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 233001 - 232949
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
233001 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
232949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 7644460 - 7644512
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
7644460 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
7644512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 7666203 - 7666255
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
7666203 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgaacccct |
7666255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 11530070 - 11530018
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
11530070 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
11530018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 18988182 - 18988234
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
18988182 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
18988234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 31250779 - 31250727
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
31250779 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31250727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 34362823 - 34362875
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
34362823 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
34362875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 41707721 - 41707773
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
41707721 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
41707773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 45289810 - 45289758
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
45289810 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45289758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 50513352 - 50513300
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
50513352 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
50513300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 34957670 - 34957615
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
34957670 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
34957615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 39136301 - 39136351
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
39136301 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggaccc |
39136351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 10046246 - 10046201
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10046246 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
10046201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 12640823 - 12640868
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
12640823 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
12640868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 22159832 - 22159877
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
22159832 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
22159877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 34363128 - 34363083
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
34363128 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
34363083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 44921920 - 44921875
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
44921920 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
44921875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 47853979 - 47854024
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
47853979 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
47854024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 104203 - 104255
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
104203 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
104255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 3770470 - 3770418
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||||| ||||| |
|
|
| T |
3770470 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatgaccccct |
3770418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 5344273 - 5344317
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5344273 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttat |
5344317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 11159730 - 11159678
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
11159730 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11159678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 11529762 - 11529814
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
11529762 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
11529814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 14578441 - 14578493
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
14578441 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgtacccct |
14578493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 14578750 - 14578698
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
14578750 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
14578698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 17262395 - 17262343
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
17262395 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
17262343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 17554045 - 17554093
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
17554045 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
17554093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 17554356 - 17554304
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
17554356 |
ttaattgcacttttggacccctatcttttcaaaagttgcgattatggacccct |
17554304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20466388 - 20466440
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
20466388 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
20466440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 20472549 - 20472597
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
20472549 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
20472597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 23315688 - 23315636
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
23315688 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
23315636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 23770080 - 23770032
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
23770080 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
23770032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 24415384 - 24415332
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
24415384 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
24415332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 24542757 - 24542809
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
24542757 |
ttaattgcacttttggacccctatcttttcaaaagttacggttatggacccct |
24542809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 24543056 - 24543008
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
24543056 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcagttatg |
24543008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 27246862 - 27246914
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
27246862 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27246914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 27751474 - 27751422
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
27751474 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
27751422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 28158896 - 28158944
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
28158896 |
ggtttaattgcacttttggatccctatcttttcaaaagttgcggttatg |
28158944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 30998497 - 30998449
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
30998497 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
30998449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 34158786 - 34158738
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
34158786 |
ggtttaattgcacttttggatccctatcttttcaaaagttgcggttatg |
34158738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 35364199 - 35364251
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
35364199 |
ttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
35364251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 37289458 - 37289510
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
37289458 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
37289510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 37289766 - 37289714
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
37289766 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
37289714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 37432528 - 37432484
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37432528 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttat |
37432484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 38371274 - 38371326
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
38371274 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
38371326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 41205501 - 41205553
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
41205501 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41205553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 41205806 - 41205754
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
41205806 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
41205754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 42672378 - 42672326
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
42672378 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42672326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 45289503 - 45289555
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
45289503 |
ttaaatgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
45289555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 51537433 - 51537485
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
51537433 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
51537485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 51537926 - 51537874
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| ||||||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
51537926 |
ttaatttcacttttggacccctatctttccaaaagttgcggttatgaacccct |
51537874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 52045724 - 52045776
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
52045724 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52045776 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 52310804 - 52310856
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
52310804 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52310856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 52311112 - 52311060
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
52311112 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
52311060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 55586619 - 55586671
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
55586619 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
55586671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 8482862 - 8482913
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccc |
208 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||| ||||| |
|
|
| T |
8482862 |
ttaattgcacttttggacccctattttttcaaaagttgcggttatggacccc |
8482913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 29432047 - 29432102
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| |||||||| ||||||||| |
|
|
| T |
29432047 |
ggtttaattgcacttttggacccctatctttccaaaaattgcggttgtgaacccct |
29432102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 31844097 - 31844046
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccc |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
31844097 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccc |
31844046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 159 - 209
Target Start/End: Complemental strand, 1377895 - 1377845
Alignment:
| Q |
159 |
aattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
1377895 |
aattgcactttaggacccctatcttttcaaaagttgcggttatgaccccct |
1377845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 7705593 - 7705643
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
7705593 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
7705643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 12641129 - 12641079
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
12641129 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggaccc |
12641079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 209
Target Start/End: Original strand, 18994668 - 18994722
Alignment:
| Q |
155 |
gtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
18994668 |
gtttaattgcacttttggacccctatctttcgaaaagttgcggttatgaccccct |
18994722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 155 - 209
Target Start/End: Complemental strand, 31209530 - 31209476
Alignment:
| Q |
155 |
gtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
31209530 |
gtttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
31209476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 4902466 - 4902421
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
4902466 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
4902421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 7119904 - 7119859
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
7119904 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatg |
7119859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 7396144 - 7396189
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
7396144 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
7396189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 13019276 - 13019321
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
13019276 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatg |
13019321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 13021289 - 13021244
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
13021289 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
13021244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 21536883 - 21536928
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
21536883 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
21536928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 27247169 - 27247124
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
27247169 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
27247124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 203
Target Start/End: Original strand, 31560041 - 31560090
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatga |
203 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
31560041 |
ggtttaattgtacttttggacccctttctttctaaaagttgcggttatga |
31560090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 39332322 - 39332367
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39332322 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatg |
39332367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 43821722 - 43821767
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
43821722 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
43821767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 46282763 - 46282808
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
46282763 |
ttaattgcacttttgaacccctatcttttcaaaagttgcggttatg |
46282808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 51696539 - 51696584
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
51696539 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
51696584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 154 - 207
Target Start/End: Complemental strand, 54607191 - 54607138
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||| ||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
54607191 |
ggtttaattttacttttggatccctatcttttcaaaagttgcggttatgaaccc |
54607138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 56296620 - 56296665
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
56296620 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
56296665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 104510 - 104458
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
104510 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
104458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 1377608 - 1377660
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
1377608 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
1377660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 5344581 - 5344529
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
5344581 |
ttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
5344529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 6386734 - 6386786
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |||||| |||||| |
|
|
| T |
6386734 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
6386786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 6769106 - 6769054
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| ||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
6769106 |
ttaattacacttttggacccctatcttttcaaaagttgtggttatggacccct |
6769054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 7666508 - 7666456
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
7666508 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
7666456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 7705899 - 7705847
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
7705899 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
7705847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 8891657 - 8891709
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
8891657 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
8891709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 8891963 - 8891911
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
8891963 |
ttaattgcactttaggacccctatcttttcaaaagttgtggttatggacccct |
8891911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 13607920 - 13607972
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
13607920 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
13607972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 17262093 - 17262145
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
17262093 |
ttaattgcactcttggaccactatcttttcaaaagttgcggttatggacccct |
17262145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 18988490 - 18988438
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| ||||||||||| |||| |||||| |
|
|
| T |
18988490 |
ttaattgcacttttggacccctatctttttaaaagttgcggctatggacccct |
18988438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 19869471 - 19869423
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||| ||||||| |
|
|
| T |
19869471 |
ggtttaattgcacttttggacccctatctttccaaaagttgtggttatg |
19869423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20472856 - 20472804
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
20472856 |
ttaattgtacttttggacccctatctttccaaaagttgcggttatggacccct |
20472804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20474021 - 20473969
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
20474021 |
ttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
20473969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 22160138 - 22160086
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
22160138 |
ttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
22160086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 23419644 - 23419592
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| ||||||| |||||| |
|
|
| T |
23419644 |
ttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
23419592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 26171244 - 26171296
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||| |||||| |||||| |
|
|
| T |
26171244 |
ttaattgcacttttggacccttatcttttcaaaagttgcagttatggacccct |
26171296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 26675056 - 26675108
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
26675056 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
26675108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 162 - 202
Target Start/End: Original strand, 28981921 - 28981961
Alignment:
| Q |
162 |
tgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28981921 |
tgcacttttggacccctatcttttcaaaagttgcggttatg |
28981961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 29432357 - 29432305
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||| |||||||| |||||| |
|
|
| T |
29432357 |
ttaattgcacttttggatccctatcttttcaaaagttacggttatggacccct |
29432305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 29548490 - 29548438
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
29548490 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
29548438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 31250478 - 31250526
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
31250478 |
ggtttaattgcatttttggacccctatctttccaaaagttgcggttatg |
31250526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 31843787 - 31843835
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||||| ||||||| |
|
|
| T |
31843787 |
ggtttaattacacttttggacccctatcttttcaaaagttgtggttatg |
31843835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 35083891 - 35083839
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| ||||| |||||| |
|
|
| T |
35083891 |
ttaattgcacttttggacctctatcttttcaaaagttgcgattatggacccct |
35083839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 35364505 - 35364453
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| ||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
35364505 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
35364453 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 35835779 - 35835831
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || |||||||| |||||| |
|
|
| T |
35835779 |
ttaattgcacttttggacccctatcttttcaaaatttacggttatggacccct |
35835831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 37973821 - 37973773
Alignment:
| Q |
161 |
ttgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||||||||||||||||||| |
|
|
| T |
37973821 |
ttgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
37973773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 43822008 - 43821956
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| |||||||| ||||| |
|
|
| T |
43822008 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatgaccccct |
43821956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 44921614 - 44921662
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||| | |||||| |||||||||||||||| |
|
|
| T |
44921614 |
ggtttaattgcacttttggacccttatctttttaaaagttgcggttatg |
44921662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 47854290 - 47854238
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||||||||| |||||| |
|
|
| T |
47854290 |
ttaattgcacttttggacccctatatttccaaaagttgcggttatggacccct |
47854238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 48278226 - 48278174
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
48278226 |
ttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
48278174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 51696839 - 51696787
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||| |||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
51696839 |
ttaatagcacttttggacccctatctttccaaaagttgcggttatggacccct |
51696787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 52046026 - 52045974
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
52046026 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
52045974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 52114444 - 52114392
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
52114444 |
ttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
52114392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 54215959 - 54216011
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||||| |||||| |
|
|
| T |
54215959 |
ttaattgcacttttggacccctatctttccgaaagttgcggttatggacccct |
54216011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 54216267 - 54216215
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| ||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
54216267 |
ttaattgcacttttgaacctctatcttttcaaaagttgcggttatggacccct |
54216215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 55586927 - 55586875
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| | ||||||||||||||| |||||| |
|
|
| T |
55586927 |
ttaattgcacttttggacccctatctttccgaaagttgcggttatggacccct |
55586875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 56296911 - 56296863
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||| || ||||||||| ||||||||||||||||||||||| |
|
|
| T |
56296911 |
ggtttaattgcatttctggacccctatcttttcaaaagttgcggttatg |
56296863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 6768797 - 6768852
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||| | ||||| |||||||||||||||| |||||| |
|
|
| T |
6768797 |
ggtttaattgcacttttggacccttatctttctaaaagttgcggttatggacccct |
6768852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 34158471 - 34158526
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||| |||||||||||| ||||| ||||| ||||||||||| |||||| |
|
|
| T |
34158471 |
ggtttaattgcatttttggacccctatctttccaaaaattgcggttatggacccct |
34158526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 201
Target Start/End: Original strand, 37973513 - 37973560
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
37973513 |
ggtttaattgcacttttggacccctatctttctaaaagttgcggttat |
37973560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 48277919 - 48277970
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccc |
208 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||| ||||||| ||||| |
|
|
| T |
48277919 |
ttaattgcatttttggacccctatcttttcaaaagttgtggttatggacccc |
48277970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 13306966 - 13306924
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
13306966 |
ggtttaattgcacttttggccccctatcttttcaaaagttgcg |
13306924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 195
Target Start/End: Complemental strand, 21537187 - 21537149
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgc |
195 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21537187 |
ttaattgcacttttggacccctatcttttcaaaagttgc |
21537149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 39136607 - 39136557
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||| ||||||||| |||| |
|
|
| T |
39136607 |
ttaattgcacttttggacccctatctttccaaaagtagcggttatggaccc |
39136557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 161 - 207
Target Start/End: Complemental strand, 51537737 - 51537691
Alignment:
| Q |
161 |
ttgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
51537737 |
ttgcacttttggacccctatctttccaaaagttgcggttatggaccc |
51537691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 209
Target Start/End: Original strand, 4107507 - 4107560
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||| | |||||| |||||| |
|
|
| T |
4107507 |
tttaattgcatttttggacccctatcttttcaaaagttacagttatggacccct |
4107560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 4902139 - 4902184
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
4902139 |
ttaattgcacttttggacccctatctttccaaaagttgctgttatg |
4902184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 24415076 - 24415121
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
24415076 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatg |
24415121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 26171550 - 26171505
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||| |||||||| |
|
|
| T |
26171550 |
ttaattgcacttttggacctctatcttttcaaaagttacggttatg |
26171505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 156 - 209
Target Start/End: Complemental strand, 28982223 - 28982170
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | | ||||||||||||||||||||| |||||| |
|
|
| T |
28982223 |
tttaattgcacttttggacctatattttttcaaaagttgcggttatggacccct |
28982170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 39332608 - 39332563
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||| |||||| |||||| |||||||||||||||| |
|
|
| T |
39332608 |
ttaattgcacttttgaacccctatctttttaaaagttgcggttatg |
39332563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 47821478 - 47821523
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
47821478 |
ttaattgcacttttggacccctatctttcaaaaagttgcggttatg |
47821523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 50513048 - 50513093
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||| |||||| |
|
|
| T |
50513048 |
ttaattgcacttttggactcctatcttttcaaaagttgcagttatg |
50513093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 54556617 - 54556662
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
54556617 |
ttaattgcacttttggacccctatttttccaaaagttgcggttatg |
54556662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 7119597 - 7119649
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| ||||||||| |||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
7119597 |
ttaattgtacttttggatccctatctttccaaaagttgcggttatggacccct |
7119649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 7644769 - 7644717
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
7644769 |
ttaattgcacttttgaacccctatctttctaaaagttgcggttatggacccct |
7644717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 8483170 - 8483126
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||||||||||||| || | |||||||||||||||||||| |
|
|
| T |
8483170 |
ttaattgcacttttggacctctattttttcaaaagttgcggttat |
8483126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 17266057 - 17266013
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
17266057 |
ttaattgcacttttggacccctatctttctaaaagttgcggttat |
17266013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 18995113 - 18995061
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| | |||||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
18995113 |
ttaattgtatttttggacccctatctttccaaaagttgcggttatgaccccct |
18995061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 26675365 - 26675314
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
26675365 |
ttaattgcacttttggaccc-tatctttccaaaagttgcggttatggacccct |
26675314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 29548183 - 29548227
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||| | ||||| |||||||||||||||| |
|
|
| T |
29548183 |
ttaattgcacttttggacccttatctttccaaaagttgcggttat |
29548227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 161 - 209
Target Start/End: Complemental strand, 29627913 - 29627865
Alignment:
| Q |
161 |
ttgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
29627913 |
ttgcatttttggacccctatctttccaaaagttgcggttatggacccct |
29627865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 31209227 - 31209279
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
31209227 |
ttaattggacttttggacccatatctttccaaaagttgcggttatggacccct |
31209279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 34957381 - 34957432
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| || | ||||||||||||||||||||||| |||||| |
|
|
| T |
34957381 |
ttaattgcacttttggatcc-tatcttttcaaaagttgcggttatggacccct |
34957432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 38371574 - 38371522
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||| ||||||||||||| || ||||||||||| ||||||||||| |||||| |
|
|
| T |
38371574 |
ttaatcgcacttttggacctctatcttttcaaaaattgcggttatggacccct |
38371522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 39946387 - 39946335
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||| ||||||| |||||| |
|
|
| T |
39946387 |
ttaattgcacttttggacccttatctttccaaaagttgtggttatggacccct |
39946335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 42672071 - 42672115
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
42672071 |
ttaattgcacttttggacccctatctttcaaaaagttgcggttat |
42672115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 47821633 - 47821581
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||| | |||||||||||||||| ||||| |
|
|
| T |
47821633 |
ttaattgcacttttagacccctatctttccgaaagttgcggttatgaccccct |
47821581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 50996038 - 50996090
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
50996038 |
ttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
50996090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 54556925 - 54556873
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || ||||| |||||||||||||||| |||||| |
|
|
| T |
54556925 |
ttaattgcacttttggacctctatctttctaaaagttgcggttatggacccct |
54556873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 200
Target Start/End: Original strand, 3065963 - 3066006
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
3065963 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
3066006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Complemental strand, 9592441 - 9592402
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
9592441 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
9592402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 12892827 - 12892866
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
12892827 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
12892866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 17221612 - 17221561
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccc |
208 |
Q |
| |
|
||||||| ||||||||| || | ||||||||||||||||||||||| ||||| |
|
|
| T |
17221612 |
ttaattgtacttttggatccttatcttttcaaaagttgcggttatggacccc |
17221561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 29860655 - 29860694
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
29860655 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
29860694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 36945516 - 36945555
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
36945516 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
36945555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 193
Target Start/End: Original strand, 44120756 - 44120795
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagtt |
193 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
44120756 |
ggtttaattgcacttttggccccctatcttttcaaaagtt |
44120795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 195
Target Start/End: Complemental strand, 1186998 - 1186960
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgc |
195 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
1186998 |
ttaattgcacttttggccccctatcttttcaaaagttgc |
1186960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 195
Target Start/End: Original strand, 2016258 - 2016296
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgc |
195 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
2016258 |
ttaattgcacttttggccccctatcttttcaaaagttgc |
2016296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 156 - 202
Target Start/End: Complemental strand, 4107815 - 4107769
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||| |||| | |||||| |||||||||||||||| |
|
|
| T |
4107815 |
tttaattgcacttttgaacccttatctttttaaaagttgcggttatg |
4107769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 195
Target Start/End: Original strand, 24886535 - 24886573
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgc |
195 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
24886535 |
ttaattgcacttttggtcccctatcttttcaaaagttgc |
24886573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 199
Target Start/End: Complemental strand, 33338340 - 33338298
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtt |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
33338340 |
ttaattgcacttttggacccctatctttctaaaagttgcggtt |
33338298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 34625282 - 34625240
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
||||||||||||||||||| | ||| ||||||||||||||||| |
|
|
| T |
34625282 |
ggtttaattgcacttttggcctcctatcttttcaaaagttgcg |
34625240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 167 - 201
Target Start/End: Original strand, 54606900 - 54606934
Alignment:
| Q |
167 |
ttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |
|
|
| T |
54606900 |
ttttggacccctatcttttcaaaagttgcggttat |
54606934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 6387043 - 6386990
Alignment:
| Q |
157 |
ttaattgcacttttgga-cccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| ||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
6387043 |
ttaattgcacttttggaccccctatctttctaaaagttgcggttatggacccct |
6386990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 10045959 - 10046003
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
10045959 |
ttaattgcacttttggacccctatc-tttccaaagttgcggttatg |
10046003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 13608231 - 13608186
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||| ||||||||||| ||| |||||| |||||||||||||||| |
|
|
| T |
13608231 |
ttaattacacttttggactcctatctttttaaaagttgcggttatg |
13608186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 17265852 - 17265897
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||| |||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
17265852 |
ttaattgtacttttggacccctatctttctaaaagttgcggttatg |
17265897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 23769807 - 23769852
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| | |||| |||||||| ||||||| |
|
|
| T |
23769807 |
ttaattgcacttttggacccctatttttttaaaagttgtggttatg |
23769852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 33508256 - 33508215
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggt |
198 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
33508256 |
ttaatttcacttttggacccctatctttccaaaagttgcggt |
33508215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 41787052 - 41787097
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||| ||||||||||| |
|
|
| T |
41787052 |
ttaattgcacttttggacccctatctttcaaaaaattgcggttatg |
41787097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 155 - 196
Target Start/End: Complemental strand, 47096736 - 47096696
Alignment:
| Q |
155 |
gtttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
47096736 |
gtttaattgcacttttgg-cccctatcttttcaaaagttgcg |
47096696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 196
Target Start/End: Original strand, 18961846 - 18961886
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||| |||||||| ||||| ||||||||||||||||| |
|
|
| T |
18961846 |
tttaattgtacttttggccccctatcttttcaaaagttgcg |
18961886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 19693020 - 19693072
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||| ||||| | |||||| |
|
|
| T |
19693020 |
ttaattgcacttttggacccctaactttccaaaagttgtggttacggacccct |
19693072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 19703605 - 19703657
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||| ||||| | |||||| |
|
|
| T |
19703605 |
ttaattgcacttttggacccctaactttccaaaagttgtggttacggacccct |
19703657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 27751166 - 27751218
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||| || | ||| ||||||||| ||||||| |||||| |
|
|
| T |
27751166 |
ttaattgcacttttggacctctatgtttccaaaagttgtggttatggacccct |
27751218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 30998186 - 30998238
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||| ||||||||| |||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
30998186 |
ttaactgcacttttagacctctatctttccaaaagttgcggttatggacccct |
30998238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 33338052 - 33338104
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||| | | ||| |||||||||||||||||| ||||| |
|
|
| T |
33338052 |
ttaattgtacttttggacccatatatttccaaaagttgcggttatgaccccct |
33338104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 40350839 - 40350891
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||| |||||||||||| ||| | ||||||||||||||||||||| |||||| |
|
|
| T |
40350839 |
ttaactgcacttttggattcctattttttcaaaagttgcggttatggacccct |
40350891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 40351147 - 40351103
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||| | | |||| ||||||||||||||| |
|
|
| T |
40351147 |
ttaattgcacttttggacccttatttttttaaaagttgcggttat |
40351103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 44121098 - 44121046
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| ||||||||| ||||| ||||||||||||||||| || ||| ||||| |
|
|
| T |
44121098 |
ttaattacacttttggccccctatcttttcaaaagttgcgattttgaccccct |
44121046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 193
Target Start/End: Complemental strand, 51843601 - 51843565
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagtt |
193 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||| |
|
|
| T |
51843601 |
ttaattgcacttttggccccctatcttttcaaaagtt |
51843565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 45; Significance: 8e-17; HSPs: 121)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 1375471 - 1375419
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
1375471 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
1375419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 11362561 - 11362609
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11362561 |
ggtttaattgcacttttggacccctatcttttcaaaagttgcggttatg |
11362609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 22194758 - 22194706
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
22194758 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22194706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 24205297 - 24205349
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
24205297 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
24205349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 24858186 - 24858134
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||||||||||| |
|
|
| T |
24858186 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatgaacccct |
24858134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 24895221 - 24895169
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
24895221 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
24895169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 31784255 - 31784307
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
31784255 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
31784307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 39642732 - 39642784
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
39642732 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
39642784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 40493955 - 40493903
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
40493955 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
40493903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 156 - 203
Target Start/End: Complemental strand, 8739140 - 8739093
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatga |
203 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8739140 |
tttaattgcacttttggacccctatcttttcaaaagttgcggttatga |
8739093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 19025827 - 19025878
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccc |
208 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19025827 |
ttaattgcactttttgacccctatcttttcaaaagttgcggttatgaacccc |
19025878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 35699165 - 35699110
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
35699165 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
35699110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 41829778 - 41829723
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| || ||||||||||||||||||||||| |||||| |
|
|
| T |
41829778 |
ggtttaattgcacttttggacctctatcttttcaaaagttgcggttatggacccct |
41829723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 42445372 - 42445427
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
42445372 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
42445427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 315018 - 315066
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
315018 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
315066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 1466813 - 1466865
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
1466813 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
1466865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 1467118 - 1467066
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
1467118 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
1467066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 2936792 - 2936844
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||| |||||| |
|
|
| T |
2936792 |
ttaattgcacttttggacccttatcttttcaaaagttgcggttatggacccct |
2936844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 15977519 - 15977467
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
15977519 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
15977467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 17799142 - 17799094
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
17799142 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
17799094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 19256899 - 19256847
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
19256899 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
19256847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 19368803 - 19368751
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||||||||||||| ||||| |
|
|
| T |
19368803 |
ttaattgcacttttggacccttatcttttcaaaagttgcggttatgaccccct |
19368751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20436061 - 20436113
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
20436061 |
ttaattgcacttttggacccctatcttttcaaaagttgcagttatggacccct |
20436113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 21552544 - 21552596
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
21552544 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
21552596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 21552851 - 21552799
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||| |||||| |
|
|
| T |
21552851 |
ttaattgcacttttggacccatatcttttcaaaagttgcggttatggacccct |
21552799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 21843490 - 21843438
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||||||||||||||||||| |
|
|
| T |
21843490 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatgaacccct |
21843438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 22093238 - 22093290
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
22093238 |
ttaaatgcacttttggacccctatcttttcaaaagttgcggttatggacccct |
22093290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 22093528 - 22093476
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
22093528 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatggacccct |
22093476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 36987723 - 36987671
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
36987723 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
36987671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 38731282 - 38731326
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38731282 |
ttaattgcacttttggacccctatcttttcaaaagttgcggttat |
38731326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 40493649 - 40493701
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||| |||||| |
|
|
| T |
40493649 |
ttaattgcacttttggacccctatctttttaaaagttgcggttatggacccct |
40493701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 1374798 - 1374853
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| ||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
1374798 |
ggtttaattgcacttttagacccctatctttccaaaagttgcggttatggacccct |
1374853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 17798851 - 17798896
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
17798851 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
17798896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 23000819 - 23000774
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
23000819 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
23000774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 24894972 - 24895017
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
24894972 |
ttaattgcacttttggatccctatcttttcaaaagttgcggttatg |
24895017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 25429925 - 25429970
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
25429925 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
25429970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 33004712 - 33004757
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
33004712 |
ttaattgcacttttggacccctatcttttcaaaagttgcagttatg |
33004757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 33005003 - 33004950
Alignment:
| Q |
157 |
ttaattgcacttttgga-cccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
33005003 |
ttaattgcacttttggatcccctatcttttcaaaagttgcggttatggacccct |
33004950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 36566606 - 36566651
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
36566606 |
ttaattgcacttctggacccctatcttttcaaaagttgcggttatg |
36566651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 36589734 - 36589779
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
36589734 |
ttaattgcacttttggacccttatcttttcaaaagttgcggttatg |
36589779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 36590022 - 36589977
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||||||||| |
|
|
| T |
36590022 |
ttaattgcacttttggacccttatcttttcaaaagttgcggttatg |
36589977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 1375049 - 1375101
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| |||||||| |||||| |
|
|
| T |
1375049 |
ttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
1375101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 1375396 - 1375344
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
1375396 |
ttaattgaacttttggacccctatctttccaaaagttgcggttatggacccct |
1375344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 8519266 - 8519314
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| |||||| ||||| ||||||||||||||||| |
|
|
| T |
8519266 |
ggtttaattgcacttttgaacccctatctttccaaaagttgcggttatg |
8519314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 10741388 - 10741336
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||| ||| ||||| |
|
|
| T |
10741388 |
ttaattgcacttttggccccctatcttttcaaaagttgcggttttgaccccct |
10741336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 13485483 - 13485431
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
13485483 |
ttaattgcacttttatacccctatcttttcaaaagttgcggttatggacccct |
13485431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 19473328 - 19473280
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
19473328 |
ggtttaattgcacttttggacccttatctttccaaaagttgcggttatg |
19473280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20494342 - 20494394
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| ||||||| |||||| |
|
|
| T |
20494342 |
ttaattgcacttttggacccctatctttttaaaagttgtggttatggacccct |
20494394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 21568235 - 21568183
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
21568235 |
ttaattgcatttttggatccctatcttttcaaaagttgcggttatggacccct |
21568183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 22194451 - 22194503
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| || |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
22194451 |
ttaatttcatttttggacccctatcttttcaaaagttgcggttatggacccct |
22194503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 22699459 - 22699511
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
22699459 |
ttaattgtacttttggacccctatcttttcaaaagttgtggttatggacccct |
22699511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 24857883 - 24857931
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
24857883 |
ggtttaattgcacttttggacctctatctttccaaaagttgcggttatg |
24857931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 25888201 - 25888149
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| |||||||| |||||| |
|
|
| T |
25888201 |
ttaattgcacttttggacccctatctttacaaaagttacggttatggacccct |
25888149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 30219016 - 30218964
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
30219016 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatgaccccct |
30218964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 31784561 - 31784509
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| ||||||| |||| ||||||||||||||||||||||| |||||| |
|
|
| T |
31784561 |
ttaattgcatttttggatccctatcttttcaaaagttgcggttatggacccct |
31784509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 36566761 - 36566709
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||| ||||||||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
36566761 |
ttaattgcacttctggacccctatctttccaaaagttgcggttatgaccccct |
36566709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 36987415 - 36987467
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||| ||||| |||||| |
|
|
| T |
36987415 |
ttaattgcacttttggacccctatctttccaaaagttgcgtttatggacccct |
36987467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 40324637 - 40324689
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
40324637 |
ttaattgcacttttggatccctatcttttcaaaagttgcgattatggacccct |
40324689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 40711339 - 40711391
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||| | |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
40711339 |
ttaattgtatttttggacccctatcttttcaaaagttgcggttatggacccct |
40711391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 41071832 - 41071884
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
41071832 |
ttaattgcacttttgaacccctatctttccaaaagttgcggttatggacccct |
41071884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 41072138 - 41072086
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
41072138 |
ttaattgcatttttggacccctatctttccaaaagttgcggttatggacccct |
41072086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 45127146 - 45127094
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |||||| |||||| |
|
|
| T |
45127146 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatggacccct |
45127094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 45395234 - 45395286
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
45395234 |
ttaattgcacttttggacccctacctttccaaaagttgcggttatgtacccct |
45395286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 166 - 209
Target Start/End: Complemental strand, 24205597 - 24205554
Alignment:
| Q |
166 |
cttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
24205597 |
cttttggacccctatcttttcaaaagttgcggttatggacccct |
24205554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 24365183 - 24365128
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||| ||||||||| || ||||| |||||||||||||||||| ||||| |
|
|
| T |
24365183 |
ggtttaattgcatttttggacctctatctttccaaaagttgcggttatgaccccct |
24365128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 34123242 - 34123296
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
34123242 |
ggtttaattgcacttttgga-ccctatctttccaaaagttgcggttatggacccct |
34123296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 13123425 - 13123475
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||| ||||||| |||| |
|
|
| T |
13123425 |
ttaattgcacttttggacccctatctttttaaaagttgaggttatggaccc |
13123475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 156 - 202
Target Start/End: Complemental strand, 34981693 - 34981647
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||| |||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
34981693 |
tttaattgcatttttagacccctatcttttcaaaagttgcggttatg |
34981647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 156 - 209
Target Start/End: Complemental strand, 40324942 - 40324888
Alignment:
| Q |
156 |
tttaattgcactttt-ggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
40324942 |
tttaattgcactttttggacccctatctttccaaaagttgcggttatggacccct |
40324888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 3263038 - 3263083
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
3263038 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatg |
3263083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 9715159 - 9715118
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggt |
198 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||| |
|
|
| T |
9715159 |
ttaattgcacttttggacccctatctttccaaaagttgcggt |
9715118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 25430080 - 25430035
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
25430080 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatg |
25430035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 25887897 - 25887942
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
25887897 |
ttaattgcacttttggacccttatctttccaaaagttgcggttatg |
25887942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 26717451 - 26717406
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
26717451 |
ttaattgcacttttggacccatatctttccaaaagttgcggttatg |
26717406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 34850967 - 34850922
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||| |||||| |
|
|
| T |
34850967 |
ttaattgcacttttggacccctatctttccaaaagttgcagttatg |
34850922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 40506206 - 40506251
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
40506206 |
ttaattgcacttttggaccccaatctttccaaaagttgcggttatg |
40506251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 7464249 - 7464197
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| ||| ||||| |||||||| |||||||| |||||| |
|
|
| T |
7464249 |
ttaattgcacttttggactcctatctttccaaaagttacggttatggacccct |
7464197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 7537416 - 7537468
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| | |||||| |
|
|
| T |
7537416 |
ttaattgcacttttggacccctaactttccaaaagttgcggttacggacccct |
7537468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 194
Target Start/End: Complemental strand, 11134056 - 11134016
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttg |
194 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
11134056 |
ggtttaattgcacttttggtcccctatcttttcaaaagttg |
11134016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 165 - 209
Target Start/End: Complemental strand, 11362863 - 11362819
Alignment:
| Q |
165 |
acttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||| |||||| |
|
|
| T |
11362863 |
acttttggacccctatcatttcaaaagttgcggttatggacccct |
11362819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 13732477 - 13732425
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||||||||||||||| |||||| |
|
|
| T |
13732477 |
ttaattgcacttttggatccctatctttctaaaagttgcggttatggacccct |
13732425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20436363 - 20436311
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| ||||||||||||||| | |||||||||||||| |||||| |||||| |
|
|
| T |
20436363 |
ttaattacacttttggacccctattttttcaaaagttgctgttatggacccct |
20436311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 23000527 - 23000575
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||| | | ||| ||||||||||||||||| |
|
|
| T |
23000527 |
ggtttaattgcacttttggacccttatttttccaaaagttgcggttatg |
23000575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 34850677 - 34850725
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||| | | ||| ||||||||||||||||| |
|
|
| T |
34850677 |
ggtttaattgcacttttggacccttatttttccaaaagttgcggttatg |
34850725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 156 - 196
Target Start/End: Original strand, 34922226 - 34922266
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
34922226 |
tttaattgcacttttggccccctatcttttcaaaagttgcg |
34922266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 201
Target Start/End: Complemental strand, 38731589 - 38731545
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||||||| ||||| |
|
|
| T |
38731589 |
ttaattgcacttttggactcctatcttttcaaaagttgcagttat |
38731545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 39431479 - 39431427
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| ||| || |||||| |||||||||||||||| |||||| |
|
|
| T |
39431479 |
ttaattgcacttttgaacctctatctttttaaaagttgcggttatggacccct |
39431427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 39620548 - 39620600
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||| |||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
39620548 |
ttaattgcacttttgggtccctatctttccaaaagttgcggttatggacccct |
39620600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 40445576 - 40445628
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| |||| ||||||||||||| ||||| |
|
|
| T |
40445576 |
ttaattgcacttttggacccatatctttccaaacgttgcggttatgaccccct |
40445628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 42445682 - 42445630
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||||||||||||||| |||||| |
|
|
| T |
42445682 |
ttaattgcacttttggatccctatctttctaaaagttgcggttatggacccct |
42445630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 45126842 - 45126894
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| | | | ||||||||||||||||| |||||| |
|
|
| T |
45126842 |
ttaattgcacttttggacccctatatatccaaaagttgcggttatggacccct |
45126894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Complemental strand, 2755260 - 2755221
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
2755260 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
2755221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 201
Target Start/End: Complemental strand, 19026130 - 19026083
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||| | |||| ||||| |||||||||||||||| |
|
|
| T |
19026130 |
ggtttaattgcacttttgaatccctatctttccaaaagttgcggttat |
19026083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 31025878 - 31025917
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
31025878 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
31025917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 32661407 - 32661446
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
32661407 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
32661446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 34470032 - 34470071
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
34470032 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
34470071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 39431169 - 39431224
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| || || ||||| ||||||||||||||||| |||||| |
|
|
| T |
39431169 |
ggtttaattgcacttttgaacttctatctttccaaaagttgcggttatggacccct |
39431224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 41454515 - 41454554
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
41454515 |
ttaattgcacttttggccccctatcttttcaaaagttgcg |
41454554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 41829471 - 41829522
Alignment:
| Q |
157 |
ttaattgcactttt-ggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||| |||||||| ||||| ||||||||||||||||| |||| |
|
|
| T |
41829471 |
ttaattgcactttttggacccctatctttccaaaagttgcggttatggaccc |
41829522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 207
Target Start/End: Original strand, 7463950 - 7464000
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
||||||||||||||| |||||| |||||| |||||||| ||||||| |||| |
|
|
| T |
7463950 |
ttaattgcacttttgaacccctatctttttaaaagttgtggttatgtaccc |
7464000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 207
Target Start/End: Complemental strand, 11367110 - 11367060
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaaccc |
207 |
Q |
| |
|
|||||||||||||||||||| | ||||| |||||||||||| |||| |||| |
|
|
| T |
11367110 |
ttaattgcacttttggacccttatctttccaaaagttgcggctatggaccc |
11367060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 159 - 209
Target Start/End: Complemental strand, 39620856 - 39620806
Alignment:
| Q |
159 |
aattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| || | ||||||||| ||||||||||| |||||| |
|
|
| T |
39620856 |
aattgcacttttggacctctattttttcaaaatttgcggttatggacccct |
39620806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 315313 - 315268
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| | ||||| |||||||||||||||| |
|
|
| T |
315313 |
ttaattgcacttttggacccatatctttctaaaagttgcggttatg |
315268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 161 - 202
Target Start/End: Complemental strand, 3263322 - 3263281
Alignment:
| Q |
161 |
ttgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
3263322 |
ttgcacttttggacccctatctttctaaaagttgcggttatg |
3263281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 5036512 - 5036557
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||| | | |||||| |||||||||||||||| |
|
|
| T |
5036512 |
ttaattgcacttttggactcttatctttttaaaagttgcggttatg |
5036557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 11366801 - 11366854
Alignment:
| Q |
157 |
ttaattgcacttttggacccctt-tcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||| |||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
11366801 |
ttaattacacttttggaccccctatctttccaaaagttgcggttatggacccct |
11366854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 194
Target Start/End: Original strand, 12542142 - 12542179
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttg |
194 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
12542142 |
ttaattgcacttttggccccctatcttttcaaaagttg |
12542179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 19473079 - 19473124
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||| |||||||||||| ||||| |||||||||||||||| |
|
|
| T |
19473079 |
ttaattgcatttttggacccctatctttctaaaagttgcggttatg |
19473124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 34123551 - 34123506
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||| ||||||| | |||| |||||||||||||||| |
|
|
| T |
34123551 |
ttaattgcacttttagacccctattttttaaaaagttgcggttatg |
34123506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 39245975 - 39245930
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||| ||||| |
|
|
| T |
39245975 |
ttaattgcacttttggacccatatctttccaaaagttgcgattatg |
39245930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 1381041 - 1380993
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||| |||||| |||| ||||||||||||||| ||||||| |
|
|
| T |
1381041 |
ggtttaattgcatttttggctccctatcttttcaaaagttgtggttatg |
1380993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 2382867 - 2382815
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| |||||| | ||| ||||||||||||||||| |||||| |
|
|
| T |
2382867 |
ttaattgcacttttaaacccctatatttccaaaagttgcggttatggacccct |
2382815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 196
Target Start/End: Complemental strand, 3414911 - 3414871
Alignment:
| Q |
156 |
tttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
|||||||||||||||| |||||| ||||| ||||||||||| |
|
|
| T |
3414911 |
tttaattgcacttttgaacccctatctttccaaaagttgcg |
3414871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 4094869 - 4094817
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| | ||||| ||||||||||||||||| || ||| ||||| |
|
|
| T |
4094869 |
ttaattgcactttttgccccctatcttttcaaaagttgcgattttgatcccct |
4094817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 8738851 - 8738895
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||| |||||||||| |
|
|
| T |
8738851 |
ttaattgcacttttggacccctacctttacaaaaattgcggttat |
8738895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 9484704 - 9484756
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
9484704 |
ttaattgcacttttaaacctctatctttccaaaagttgcggttatggacccct |
9484756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 198
Target Start/End: Complemental strand, 16238536 - 16238492
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggt |
198 |
Q |
| |
|
|||||||||||| ||||| ||||| ||||||||||||||||||| |
|
|
| T |
16238536 |
ggtttaattgcatttttgatcccctatcttttcaaaagttgcggt |
16238492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 34981388 - 34981431
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
34981388 |
ttaattgcatttttggaccc-tatcttttcaaaagttgcggttat |
34981431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 35173123 - 35173072
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||||||||||| || ||| ||||| |
|
|
| T |
35173123 |
ttaattgcacttttgg-cccctatcttttcaaaagttgcgattttgaccccct |
35173072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 39374103 - 39374155
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||| || || ||||||||||||||||| || ||| ||||| |
|
|
| T |
39374103 |
ttaattgcacttttggccctctatcttttcaaaagttgcgattttgatcccct |
39374155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 45395548 - 45395496
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||| |||| ||||| |||| ||||||||||| |||||| |
|
|
| T |
45395548 |
ttaattgcacttttggatccctatctttctaaaaattgcggttatggacccct |
45395496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022 (Bit Score: 44; Significance: 3e-16; HSPs: 2)
Name: scaffold0022
Description:
Target: scaffold0022; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 139487 - 139432
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
139487 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
139432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0022; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Original strand, 139175 - 139230
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
139175 |
ggtttaattgcacttttggatccctatctttccaaaagttgcggttatggacccct |
139230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0951 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0951
Description:
Target: scaffold0951; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 3705 - 3753
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
3705 |
ggtttaattgcacttttggacccctatctttccaaaagttgcggttatg |
3753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0922 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0922
Description:
Target: scaffold0922; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 143 - 91
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
143 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
91 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0606 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0606
Description:
Target: scaffold0606; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 6871 - 6923
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
6871 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
6923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0474
Description:
Target: scaffold0474; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 8031 - 7979
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
8031 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
7979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0474; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 7724 - 7769
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
7724 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
7769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 4)
Name: scaffold0370
Description:
Target: scaffold0370; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 10938 - 10886
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
10938 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
10886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 16228 - 16176
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
16228 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
16176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 10631 - 10683
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||||||||||| ||||| |||||| |
|
|
| T |
10631 |
ttaattgcacttttagacccctatctttccaaaagttgcgattatggacccct |
10683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0370; HSP #4
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 15921 - 15973
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||||||||||| ||||| |||||| |
|
|
| T |
15921 |
ttaattgcacttttagacccctatctttccaaaagttgcgattatggacccct |
15973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 4)
Name: scaffold0272
Description:
Target: scaffold0272; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 10871 - 10819
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
10871 |
ttaattgcatttttggacccctatcttttcaaaagttgcggttatggacccct |
10819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 201
Target Start/End: Original strand, 20871 - 20915
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttat |
201 |
Q |
| |
|
||||||||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
20871 |
ttaattgcacttttggacctctatcttttcaaaagttgcggttat |
20915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 195
Target Start/End: Original strand, 10562 - 10600
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgc |
195 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||| |
|
|
| T |
10562 |
ttaattgcacttttggacccctatcttttccaaagttgc |
10600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0272; HSP #4
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 198
Target Start/End: Complemental strand, 21159 - 21118
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggt |
198 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||||||| |
|
|
| T |
21159 |
ttaattgcatttttggacccctatctttccaaaagttgcggt |
21118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0122
Description:
Target: scaffold0122; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 29653 - 29705
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
29653 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
29705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0122; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 29961 - 29909
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||| |||||||| |||||| |
|
|
| T |
29961 |
ttaattgcacttttggacccctatctttccaaaagttacggttatggacccct |
29909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0035
Description:
Target: scaffold0035; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 81612 - 81560
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
81612 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
81560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0035; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 81308 - 81360
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||||||||| |||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
81308 |
ttaattgcacttttgaacccctatctttccaaaagttgtggttatggacccct |
81360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0016
Description:
Target: scaffold0016; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 75388 - 75340
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
75388 |
ggtttaattgcacttttggactcctatcttttcaaaagttgcggttatg |
75340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0016; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 75113 - 75165
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| | ||| |||||||||| |||||| |||||| |
|
|
| T |
75113 |
ttaattgcacttttggacccctatttttccaaaagttgccgttatggacccct |
75165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 238625 - 238677
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| ||||||| |||||| |
|
|
| T |
238625 |
ttaattgcacttttggacccctatcttttcaaaagttgtggttatggacccct |
238677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 238934 - 238882
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
238934 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatgtacccct |
238882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 2)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 401016 - 400964
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
401016 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatggacccct |
400964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 400707 - 400752
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
400707 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
400752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 40; Significance: 0.00000000000008; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 154 - 209
Target Start/End: Complemental strand, 14618 - 14563
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| || ||||| ||||||||||||||||| |||||| |
|
|
| T |
14618 |
ggtttaattgcacttttggacctctatctttccaaaagttgcggttatggacccct |
14563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: scaffold0693
Description:
Target: scaffold0693; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 4831 - 4785
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatga |
203 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||||| |
|
|
| T |
4831 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatga |
4785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0693; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 4544 - 4589
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||||| ||||| |
|
|
| T |
4544 |
ttaattgcacttttggacccttatcttttcaaaagttgcgtttatg |
4589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328 (Bit Score: 38; Significance: 0.000000000001; HSPs: 2)
Name: scaffold0328
Description:
Target: scaffold0328; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 16064 - 16019
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
16064 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
16019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0328; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 15774 - 15822
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| || | ||||| |||||||||||||||| |
|
|
| T |
15774 |
ggtttaattgcacttttggatccttatctttctaaaagttgcggttatg |
15822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0213 (Bit Score: 38; Significance: 0.000000000001; HSPs: 1)
Name: scaffold0213
Description:
Target: scaffold0213; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 21357 - 21312
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
21357 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
21312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 38; Significance: 0.000000000001; HSPs: 3)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 22298 - 22343
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
22298 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
22343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 22586 - 22541
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||||||||| |
|
|
| T |
22586 |
ttaattgcacttttggacccctatctttccaaaagttgcggttatg |
22541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 154 - 199
Target Start/End: Original strand, 32525 - 32569
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggtt |
199 |
Q |
| |
|
||||||||||||||||||| ||| | |||||||||||||||||||| |
|
|
| T |
32525 |
ggtttaattgcacttttggtccc-tatcttttcaaaagttgcggtt |
32569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0864 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0864
Description:
Target: scaffold0864; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 2647 - 2699
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||| ||||||| |||||| |
|
|
| T |
2647 |
ttaattgcacttttggacccctatctttccaaaagttgtggttatggacccct |
2699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0777 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0777
Description:
Target: scaffold0777; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 180 - 128
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||| |||||||||||||||| |||||| |
|
|
| T |
180 |
ttaattgcacttttggacccctatctttctaaaagttgcggttatggacccct |
128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: scaffold0352
Description:
Target: scaffold0352; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 9950 - 10002
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||| ||| ||||| ||||||||||||||||| |||||| |
|
|
| T |
9950 |
ttaattgcacttttggactcctatctttccaaaagttgcggttatggacccct |
10002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0352; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 157 - 202
Target Start/End: Complemental strand, 10247 - 10202
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||| |||||||||||| ||||| |||||||||||||||| |
|
|
| T |
10247 |
ttaattgcatttttggacccctatctttctaaaagttgcggttatg |
10202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 157 - 209
Target Start/End: Complemental strand, 20936 - 20884
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||| | ||||| ||||||||||||||||| |||||| |
|
|
| T |
20936 |
ttaattgcacttttggacccttatctttccaaaagttgcggttatggacccct |
20884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 20625 - 20681
Alignment:
| Q |
157 |
ttaattgcacttttggacccctt----tcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
20625 |
ttaattgcacttttggacccctccctatcttttcaaaagttgcggttatggacccct |
20681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1171 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold1171
Description:
Target: scaffold1171; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 208
Target Start/End: Original strand, 822 - 873
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccc |
208 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||||||||||| ||||| ||||| |
|
|
| T |
822 |
ttaattgcacttttggacccctatctttccaaaagttgcgtttatggacccc |
873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold1067
Description:
Target: scaffold1067; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 198
Target Start/End: Original strand, 1358 - 1399
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggt |
198 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
1358 |
ttaattgcacttttggatccctatcttttcaaaagttgcggt |
1399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1067; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 1648 - 1601
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
|||||||||||||||||||| |||| ||||| ||||||||||||||||| |
|
|
| T |
1648 |
ggtttaattgcacttttgga-ccctatctttccaaaagttgcggttatg |
1601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 202
Target Start/End: Original strand, 26266 - 26311
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||| || ||| ||||||||||||||||||||||| |
|
|
| T |
26266 |
ttaattgcacttttgaactcctatcttttcaaaagttgcggttatg |
26311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 159 - 202
Target Start/End: Complemental strand, 26555 - 26512
Alignment:
| Q |
159 |
aattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||| || ||||| ||||||||||||||||| |
|
|
| T |
26555 |
aattgcacttttggacctctatctttccaaaagttgcggttatg |
26512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 202
Target Start/End: Original strand, 16519 - 16567
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
16519 |
ggtttaattgctcttttggattcctatcttttcaaaagttgcggttatg |
16567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 157 - 200
Target Start/End: Original strand, 21841 - 21884
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggtta |
200 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||| |
|
|
| T |
21841 |
ttaattgcacttttggacccctaactttccaaaagttgcggtta |
21884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0592 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0592
Description:
Target: scaffold0592; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 9020 - 8974
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatga |
203 |
Q |
| |
|
||||||||| |||||||||||| ||||| ||||||||| |||||||| |
|
|
| T |
9020 |
ttaattgcatttttggacccctatctttccaaaagttgtggttatga |
8974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 154 - 196
Target Start/End: Complemental strand, 55466 - 55424
Alignment:
| Q |
154 |
ggtttaattgcacttttggacccctttcttttcaaaagttgcg |
196 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
55466 |
ggtttaattgcacttttggttccctatcttttcaaaagttgcg |
55424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 157 - 209
Target Start/End: Original strand, 766 - 818
Alignment:
| Q |
157 |
ttaattgcacttttggacccctttcttttcaaaagttgcggttatgaacccct |
209 |
Q |
| |
|
||||||||| |||| ||||||| ||||| ||||||||||||||| | |||||| |
|
|
| T |
766 |
ttaattgcatttttagacccctatctttccaaaagttgcggttacggacccct |
818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 158 - 202
Target Start/End: Original strand, 3787 - 3830
Alignment:
| Q |
158 |
taattgcacttttggacccctttcttttcaaaagttgcggttatg |
202 |
Q |
| |
|
||||||||||||||||||| | ||||| ||||||||||||||||| |
|
|
| T |
3787 |
taattgcacttttggaccc-tatctttccaaaagttgcggttatg |
3830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University