View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10909_low_5 (Length: 354)
Name: NF10909_low_5
Description: NF10909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10909_low_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 16 - 339
Target Start/End: Complemental strand, 10932616 - 10932293
Alignment:
| Q |
16 |
agaagaacgggaaccacgcgatccagttcacggctgttactaacatcaatatccacattggtctctttaattccttgaatgcaccgaacaactctccgaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10932616 |
agaagaacgggaaccacgcgatccagttcacggctgttactaacatcaatatccacattggtctctttaattccttgaatgcaccaaacaactctccgaa |
10932517 |
T |
|
| Q |
116 |
acaagtaaccggtgtctcatcagcatccttcacctctggctttgtcttcggtgtgtcctcgacgtagatgagggcaaacgtggcaaggatgattaagagg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10932516 |
acaagtaaccggtgtctcatcagcatccttcacctctggctttgtctttggtgtgtcctcgacgtagatgagggcaaacgtggcaaggatgattaagagg |
10932417 |
T |
|
| Q |
216 |
aggatggagaaaaagaagcaactcttaagattcgcgcagaagacgttacatgcttcggtttcggtgaaggggaaaattttgtggagtttgctgtaggatc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10932416 |
aggatggagaaaaagaagcaactcttaagattcgcgcagaagacattacatgcttcggtttcggtgaaggggaagattttgtggagtttgctgtaggatc |
10932317 |
T |
|
| Q |
316 |
cggcagcatacccgaggatgtttc |
339 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
10932316 |
cggcagcatacccgaggatgtttc |
10932293 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University