View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1090_low_17 (Length: 348)

Name: NF1090_low_17
Description: NF1090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1090_low_17
NF1090_low_17
[»] chr1 (5 HSPs)
chr1 (13-141)||(2021613-2021741)
chr1 (210-248)||(2021613-2021651)
chr1 (140-177)||(31178608-31178645)
chr1 (247-284)||(31178608-31178645)
chr1 (317-348)||(2021620-2021651)


Alignment Details
Target: chr1 (Bit Score: 104; Significance: 8e-52; HSPs: 5)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 13 - 141
Target Start/End: Complemental strand, 2021741 - 2021613
Alignment:
13 aatattcatattttcttcatcttttttggattaggatattcatccgttagaaaaccatgtaaaattttccatagtttaatggaaccgaaataaatacgga 112  Q
    |||||||||||||||||||||||||||||||||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2021741 aatattcatattttcttcatcttttttggatta---tattcatccgttagaaaaccatgtaaaattttccatagtttaatggaaccgaaataaatacgga 2021645  T
113 ---ataacacacataattgataatgaagttaa 141  Q
       |||||||||||||||||||||||||||||    
2021644 ataataacacacataattgataatgaagttaa 2021613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 210 - 248
Target Start/End: Complemental strand, 2021651 - 2021613
Alignment:
210 atacggaataataacacacataattgataatgaagttaa 248  Q
    |||||||||||||||||||||||||||||||||||||||    
2021651 atacggaataataacacacataattgataatgaagttaa 2021613  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 140 - 177
Target Start/End: Original strand, 31178608 - 31178645
Alignment:
140 aacttgtgttgttcatgtgtcaacaattgatgcaccgt 177  Q
    |||||||| |||||||||||||||||||||||||||||    
31178608 aacttgtgatgttcatgtgtcaacaattgatgcaccgt 31178645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 247 - 284
Target Start/End: Original strand, 31178608 - 31178645
Alignment:
247 aacttgtgttgttcatgtgtcaacaattgatgcaccgt 284  Q
    |||||||| |||||||||||||||||||||||||||||    
31178608 aacttgtgatgttcatgtgtcaacaattgatgcaccgt 31178645  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 317 - 348
Target Start/End: Complemental strand, 2021651 - 2021620
Alignment:
317 atacggaataataacacacataattgataatg 348  Q
    ||||||||||||||||||||||||||||||||    
2021651 atacggaataataacacacataattgataatg 2021620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University