View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1090_low_17 (Length: 348)
Name: NF1090_low_17
Description: NF1090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1090_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 104; Significance: 8e-52; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 13 - 141
Target Start/End: Complemental strand, 2021741 - 2021613
Alignment:
| Q |
13 |
aatattcatattttcttcatcttttttggattaggatattcatccgttagaaaaccatgtaaaattttccatagtttaatggaaccgaaataaatacgga |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2021741 |
aatattcatattttcttcatcttttttggatta---tattcatccgttagaaaaccatgtaaaattttccatagtttaatggaaccgaaataaatacgga |
2021645 |
T |
 |
| Q |
113 |
---ataacacacataattgataatgaagttaa |
141 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2021644 |
ataataacacacataattgataatgaagttaa |
2021613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 210 - 248
Target Start/End: Complemental strand, 2021651 - 2021613
Alignment:
| Q |
210 |
atacggaataataacacacataattgataatgaagttaa |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2021651 |
atacggaataataacacacataattgataatgaagttaa |
2021613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 140 - 177
Target Start/End: Original strand, 31178608 - 31178645
Alignment:
| Q |
140 |
aacttgtgttgttcatgtgtcaacaattgatgcaccgt |
177 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31178608 |
aacttgtgatgttcatgtgtcaacaattgatgcaccgt |
31178645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 247 - 284
Target Start/End: Original strand, 31178608 - 31178645
Alignment:
| Q |
247 |
aacttgtgttgttcatgtgtcaacaattgatgcaccgt |
284 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31178608 |
aacttgtgatgttcatgtgtcaacaattgatgcaccgt |
31178645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 317 - 348
Target Start/End: Complemental strand, 2021651 - 2021620
Alignment:
| Q |
317 |
atacggaataataacacacataattgataatg |
348 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2021651 |
atacggaataataacacacataattgataatg |
2021620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University