View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1090_low_25 (Length: 251)
Name: NF1090_low_25
Description: NF1090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1090_low_25 |
 | |
|
| [»] scaffold0339 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0339 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 1 - 230
Target Start/End: Complemental strand, 15103 - 14874
Alignment:
| Q |
1 |
ccttaccactcaatgaaaggaccaaactggtcataaaacctatagatatgtctcttttggtcacacttagtgatggttgattaactactttgcaaggagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15103 |
ccttaccactcaatgaaaggaccaaactggtcataaaacctatagatatgtctcttttagtcacacttagtgatggttgattaactactttgcaaggagt |
15004 |
T |
|
| Q |
101 |
taattgtcttttcaaattgcatttgatagggttgtaagcatatgttggtgttactaatgaagattgtgatgaagatgctagatggaagggatttgctgtt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15003 |
taattgtcttttcaaattgcatttgatagggttgtaagcatatgttggtgttactaatgaagattgtgatgaagatgctagatggaagggatttgctgtt |
14904 |
T |
|
| Q |
201 |
gagagaaaatttgatgccatgttttgtttt |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
14903 |
gagagaaaatttgatgccatgttttgtttt |
14874 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 65
Target Start/End: Original strand, 21012806 - 21012875
Alignment:
| Q |
1 |
ccttaccactcaatgaaaggaccaaa-----ctggtcataaaacctatagatatgtctcttttggtcaca |
65 |
Q |
| |
|
||||| |||||||||||||||||||| ||||| | ||||| ||| ||||||||||||||||||||| |
|
|
| T |
21012806 |
ccttagcactcaatgaaaggaccaaattaaactggttacaaaacgtatggatatgtctcttttggtcaca |
21012875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University