View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1090_low_27 (Length: 251)
Name: NF1090_low_27
Description: NF1090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1090_low_27 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 26 - 251
Target Start/End: Original strand, 19235339 - 19235565
Alignment:
| Q |
26 |
tcccactatcttcttcagatccaaatataacagaacccatgacacaaatgatccatctctctctgccacatcaacatttt-ttccctcacccttcttatg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
19235339 |
tcccactatcttcttcagatccaaatataacagaacccatcacacaaatgatccatctctctctgccacatcaacatttttttccctcacccttcttatg |
19235438 |
T |
 |
| Q |
125 |
tttcctaacataaactcgccacactgtaggttttaggaagctcatgtgctaactgcacattttggcccacaccctcatttggcccttctcttttcaattt |
224 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19235439 |
tttcctaacataaactctccacactgtaggttttaggcagctcatgtgctaactgcacattttggcccacaccctcatttggcccttctcttttcaattt |
19235538 |
T |
 |
| Q |
225 |
tctaggtttgcatggttaatgaatctt |
251 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
19235539 |
tctaggtttgcatggttaatgaatctt |
19235565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University