View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1090_low_28 (Length: 251)
Name: NF1090_low_28
Description: NF1090
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1090_low_28 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 28 - 251
Target Start/End: Complemental strand, 25707901 - 25707682
Alignment:
| Q |
28 |
gtggtcctatctaatttgtaggatttatatcaaaaaatttcatcttttattatgataataatgaaacaataacaaaagcaaaattatttggcaatcgtca |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25707901 |
gtggtcctatctaatttgtaggatttatatcaaaaa-tttcatcttttat---gataataatgaaacaataacaaaagcaaaattatttggcaatcgtca |
25707806 |
T |
 |
| Q |
128 |
tgttttgatgataggaatgggatgccaaccaatcactttcccacatattgagaattttcttcccactaggttgcccgataaactctgattcctcttttgg |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
25707805 |
tgttttgatgataggaatgggatgccaaccaatcactttcccacatattgagaattttcttcccactaggttgcccgaaaaactctgattcctcttttgg |
25707706 |
T |
 |
| Q |
228 |
catcttcgatgtatagtaccccaa |
251 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
25707705 |
catcttcgatgtatagtaccccaa |
25707682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University