View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10910_low_13 (Length: 315)
Name: NF10910_low_13
Description: NF10910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10910_low_13 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 19 - 299
Target Start/End: Original strand, 37095294 - 37095574
Alignment:
| Q |
19 |
cttaacagcggtttttactctattttgttatgaatcaagtttaatgaagcaaaacaaaatacaaatgtgattcaggttatagaactcttaggaaatgaaa |
118 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37095294 |
cttaactgcggtttttactctattttgttatgaatcaagtttaatgaagcaaaacaaaacacaaatgtgattcaggttatagaactcttaggaaatgaaa |
37095393 |
T |
 |
| Q |
119 |
ttgaatataactgaatattttgagatacagattctagctaacactctactaatcatcttattccatatgaatggttattactccactccctgcagattcc |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37095394 |
ttgaatataactgaatattttgagatacagattctagctaacactctactaatcatcttattccatatgaatggttattactccactccctgcagattcc |
37095493 |
T |
 |
| Q |
219 |
attttgtgtggtcgttggatggacgattgaatgtcctatggacttgaattttaagcctttcgagacaacttcacttttcat |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37095494 |
attttgtgtggtcgttggatggacgattgaatgtcctatggacttgaattttaagcctttcgagacaacttcacttttcat |
37095574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University