View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10910_low_14 (Length: 278)
Name: NF10910_low_14
Description: NF10910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10910_low_14 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 25 - 245
Target Start/End: Original strand, 37870218 - 37870430
Alignment:
| Q |
25 |
cagggtgttgtacatttctttcctctcctgcaccatgcgccgaaaacctggacctaaaccttccaaaaccaaagacgcggtactctccttggtacacaaa |
124 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37870218 |
cagggtgttgtacttttctttcctcttctgcaccatgggccgaaaacctggacctaaaccttccaaaaccaaagacgcggtactctccttggtacacaaa |
37870317 |
T |
 |
| Q |
125 |
atccactcttttgtttttctctcatctttcttttccgttgtttcgtccgttttatgtatgtacgatattatcgttttctcatta----ttattgttgcgt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
37870318 |
atccactcttttgtttttctctcatctttcttt------------tccgttttatgtatgtacgatattatcgttttctcattattatttattgttgcgt |
37870405 |
T |
 |
| Q |
221 |
ttccattctcatgttcctattttgg |
245 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37870406 |
ttccattctcatgttcctattttgg |
37870430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University