View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10910_low_17 (Length: 217)
Name: NF10910_low_17
Description: NF10910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10910_low_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 50 - 201
Target Start/End: Original strand, 27863119 - 27863270
Alignment:
| Q |
50 |
tggacggtggagatgcggcgaaggtggaggttaataaaatggagtatcagtatccgatacaagctccgatgtattattatgaaggtcaaagtagtaatta |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27863119 |
tggacggtggagatgcggcgaaggtggaggttaataaaatggagtatcagtatccgatacaagctccgatgtattattatgaaggtcaaagtagtaatta |
27863218 |
T |
|
| Q |
150 |
tgctggtatggatcaatttcatcatcaatctggttatggtggtggttatgat |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27863219 |
tgctggtatggatcaatttcatcatcaatctggttatggtggtggttatgat |
27863270 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University