View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10912_low_26 (Length: 210)
Name: NF10912_low_26
Description: NF10912
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10912_low_26 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 178; Significance: 3e-96; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 178; E-Value: 3e-96
Query Start/End: Original strand, 17 - 206
Target Start/End: Complemental strand, 47117298 - 47117109
Alignment:
| Q |
17 |
cagaatagtcaagaggaacatcgtcatcgtcttcttcttcatcaattgtttgatgcgacataacttgtgcgagtcgttgagcagcggcttttgtggcatt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
47117298 |
cagaatagtcaagaggaacatcgtcatcgtcttcttcttcatcaattgtttgatgcgacataacttgtgcaagtcgttgagcagcggcttttgtggcatt |
47117199 |
T |
 |
| Q |
117 |
gttttgtgttctcccgatgttgttcatggcagaacctgtggaacctgcacgagcatgtcggttcaatggcgacatcatcaccggcgaaga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
47117198 |
gttttgtgttctcccgatgttgttcatggcagaacctgtggaacctgcacgagcatgtcgattcaatggcgacatcatcaccggtgaaga |
47117109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University