View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10913_high_5 (Length: 236)
Name: NF10913_high_5
Description: NF10913
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10913_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 40073438 - 40073658
Alignment:
| Q |
1 |
gtaccaaatgaacaaaaatctggctttattacatctagtatagcctacatatgatgtttttccatttgtcttctttctatgtcgttatattttacctatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
40073438 |
gtaccaaatgaacaaaaatctggctttattacatctagtatagcctacatatgatgtttttccatttgtcttctttctatgttgttatattttacctatt |
40073537 |
T |
 |
| Q |
101 |
ttgaatgttatgtattagcaactgaacttcaatctttttgacttgtgtattagctaccgaacttcaatctttttgacatttttgttcacgtt-ctccaag |
199 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
40073538 |
ttgaatgttgtgtattagctactgaacttcaatctttttgacttgtgtattagctactgaacttcaatctttttgacatttttgttcacgttcctccaag |
40073637 |
T |
 |
| Q |
200 |
cttttgtgttgaaaattatat |
220 |
Q |
| |
|
||||||| ||||||||||||| |
|
|
| T |
40073638 |
cttttgtattgaaaattatat |
40073658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University