View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10914_high_11 (Length: 272)
Name: NF10914_high_11
Description: NF10914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10914_high_11 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 39 - 264
Target Start/End: Original strand, 43852598 - 43852815
Alignment:
| Q |
39 |
aggagaggtgagaaagcttggtataaatagctgtgcatgcatgggatgagatagaggtttttggggtaggctggtagggtaaatttgaagatatttgtat |
138 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
43852598 |
aggagaggttagaaagcttggtataaatagctgtgcatgcatgggatgagatagaggtttttggggta--------gggtaaatttgaagatatttgtat |
43852689 |
T |
 |
| Q |
139 |
agagtgagtcaccacaatggtattattaattaaaattgtagtcgttggtcaatttaatttataaatttatagataatattttagtccttgaaattgaaga |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
43852690 |
agagtgagtcaccacaatggtattattaattaaaattgtagtcgttggtcaatttaatttataaatttatagataatattttactccttgaaattgaaga |
43852789 |
T |
 |
| Q |
239 |
ccatgcaaaccaatttagtctctgct |
264 |
Q |
| |
|
||||||||||||||||||||| |||| |
|
|
| T |
43852790 |
ccatgcaaaccaatttagtctttgct |
43852815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University