View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10914_high_14 (Length: 239)

Name: NF10914_high_14
Description: NF10914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10914_high_14
NF10914_high_14
[»] chr7 (3 HSPs)
chr7 (106-181)||(44254861-44254936)
chr7 (1-67)||(44254756-44254822)
chr7 (196-224)||(44254950-44254978)


Alignment Details
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 106 - 181
Target Start/End: Original strand, 44254861 - 44254936
Alignment:
106 gttgttaagaaaccatgaatgattgcatgcattgaacaaataaattacaaacattaaaatcctacaaaatagaatg 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
44254861 gttgttaagaaaccatgaatgattgcatgcattgaacaaataaattacaaacattaaaatcctacaaaatagaatg 44254936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 1 - 67
Target Start/End: Original strand, 44254756 - 44254822
Alignment:
1 attccttcgtgcttaccacatcagtcttgacatagatgaggagaacaattgcaagattaatgatata 67  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
44254756 attccttcgtgcttaccacatcagtcttgacatggatgaggagaacaattgcaagattaatgatata 44254822  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 196 - 224
Target Start/End: Original strand, 44254950 - 44254978
Alignment:
196 aatgaaaatgacctgagcagggtaaacat 224  Q
    |||||||||||||||||||||||||||||    
44254950 aatgaaaatgacctgagcagggtaaacat 44254978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University