View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10914_low_19 (Length: 221)
Name: NF10914_low_19
Description: NF10914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10914_low_19 |
 | |
|
| [»] scaffold0002 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0002 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 211
Target Start/End: Original strand, 441912 - 442106
Alignment:
| Q |
17 |
tgatatggcagccgcgttgatgccactggcgttgcaaaggttgagtcccgataatcccttacttttgaactcattgtcgtaatggacacgtttatatcta |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
441912 |
tgatatggcagccgcgttgatgccactggcgttgcaaaggttgaatcctgataatcccatacttttgaactcattgtcgtaatggacacgtttatatcta |
442011 |
T |
|
| Q |
117 |
cacatggcctcatcgtgcccatggtcttgtgtggcggacaatcagattgttccgttgaagcctccacaataatcacaattgttttcacaggttct |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
442012 |
cacatggcctcattgtgcccatggtcttgtgtggcggacaatcagattgttccgttgaagcctccacaataatcacaattgttttcacagattct |
442106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University