View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10914_low_9 (Length: 354)
Name: NF10914_low_9
Description: NF10914
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10914_low_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 313; Significance: 1e-176; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 313; E-Value: 1e-176
Query Start/End: Original strand, 12 - 340
Target Start/End: Original strand, 51278566 - 51278894
Alignment:
| Q |
12 |
atgaacatattgccaggtgcaccgaattgttgaactctaccgttcaaatatatctatatatacgtggtggtggagtgtgtgatgttacagcacgggattt |
111 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
51278566 |
atgaacatattgtcaggtgcaccgaattgttgaactctaccgttcaaatatatctatatatacgtggtggtggagtgtgtgatgttacaacacaggattt |
51278665 |
T |
 |
| Q |
112 |
tgatcaaacaggtgatatgcattatagaaaaaacaggaaaaggaagatagtgagggaggtacggtacctttcgaccggcgattttgcaggaacgtctgcc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51278666 |
tgatcaaacaggtgatatgcattatagaaaaaacaggaaaaggaagatagtaagggaggtacggtacctttcgaccggcgattttgcaggaacgtctgcc |
51278765 |
T |
 |
| Q |
212 |
catacaaagaggagtggaagtccatatggttcttcttctaactcgaactcgacggttgttgtcgttatggtaattagtaaagtttattacatttgcatcc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51278766 |
catacaaagaggagtggaagtccatatggttcttcttctaactcgaactcgacggttgttgtcgttatggtaattagtaaagtttattacatttgcatcc |
51278865 |
T |
 |
| Q |
312 |
agcagcgacggtgaaataatatgtatatt |
340 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
51278866 |
agcagcgacggtgaaataatatgtatatt |
51278894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University