View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10916_high_16 (Length: 399)
Name: NF10916_high_16
Description: NF10916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10916_high_16 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 3e-55; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 3e-55
Query Start/End: Original strand, 199 - 355
Target Start/End: Complemental strand, 38792430 - 38792276
Alignment:
| Q |
199 |
ctttcattagtttgtagttgaaatcttaacattttctattctccacataattcagctgcttaccatacattgtaaagttttaattaagcattacttcttg |
298 |
Q |
| |
|
||||||| ||| ||||||||| |||||||||||||||||||||||||||||||||||| |||| | ||||| |||||||||||||||||||||||||| |
|
|
| T |
38792430 |
ctttcatcagtctgtagttgacatcttaacattttctattctccacataattcagctggttacaagacattt--aagttttaattaagcattacttcttg |
38792333 |
T |
|
| Q |
299 |
aaaatatgaattgtgtcaatgaagaatatggcaagtgctgtaatatgcaatactttg |
355 |
Q |
| |
|
||||| | ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38792332 |
aaaatgttaattgtgtcaatgaagaatatggcaagtgctgtaatatgcaatactttg |
38792276 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 6 - 183
Target Start/End: Complemental strand, 38793055 - 38792875
Alignment:
| Q |
6 |
catagaaaagtgaagcaagtatgtacaagttcc-aggtaaaacgcgaagaccggtttccttcgcctctgcgtaac--atcactgatattacgtcaaaacc |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||| |||||| | ||||||| ||| || |||| | || |||||||||| ||||||||| |
|
|
| T |
38793055 |
catagaaaagtgaagcaagtatgtacaagttcccatgtaaaacgtgaagactgatttcctttgccgctccgtagcttattactgatattatgtcaaaacc |
38792956 |
T |
|
| Q |
103 |
acgccgaagggcagactatgacagaactgaatttgaattcagtgcagtcggtgactgtacagtcatgtaatcagacaatcc |
183 |
Q |
| |
|
| ||||||||||||||| ||| |||||||||||||||||||||||||| |||||||||| | ||||||| ||||||||||| |
|
|
| T |
38792955 |
atgccgaagggcagactgtgatagaactgaatttgaattcagtgcagtaggtgactgtataatcatgtagtcagacaatcc |
38792875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 317 - 354
Target Start/End: Original strand, 52474429 - 52474466
Alignment:
| Q |
317 |
atgaagaatatggcaagtgctgtaatatgcaatacttt |
354 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
52474429 |
atgaagattatggaaagtgctgtaatatgcaatacttt |
52474466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 3 - 62
Target Start/End: Complemental strand, 29780415 - 29780355
Alignment:
| Q |
3 |
atacatagaaaagtgaagcaagtatgta-caagttccaggtaaaacgcgaagaccggtttc |
62 |
Q |
| |
|
||||||||| ||||||||||||| || ||||||||| |||||||| ||||||||||||| |
|
|
| T |
29780415 |
atacatagacaagtgaagcaagtccctaacaagttccaagtaaaacgtgaagaccggtttc |
29780355 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University