View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10916_high_19 (Length: 369)
Name: NF10916_high_19
Description: NF10916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10916_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 309; Significance: 1e-174; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 309; E-Value: 1e-174
Query Start/End: Original strand, 18 - 354
Target Start/End: Original strand, 19172133 - 19172469
Alignment:
| Q |
18 |
aaaccagtcaccaacaacgtgttcaacgaaacagccttccgcgcgtgtaagcctatcgttaagtgttggaacgatggacttcaaaccgcactctatttgt |
117 |
Q |
| |
|
|||||||||||||||||||| || || |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19172133 |
aaaccagtcaccaacaacgtttttaatgaaacagccttccgcgcgtgtaagcctatcgttaagcgttggaacgatggacttcaaaccgcactctatttgc |
19172232 |
T |
|
| Q |
118 |
tccatacgtgttcttagggtttctgatggattcctccatgccatggctatttgccatggacgatcagaagacattgaaaccgatgaattatcattggttt |
217 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19172233 |
tccatacgtgttattagggtttctgatggattcctccacgccatggctatttgccatggacgatcagaagacattgaaaccgatgaattatcattggttt |
19172332 |
T |
|
| Q |
218 |
cggtttcattgtcttcgtcgtcaagaaaagaacgagcaagattggtgaagatgaaaggatggaggtcagagatccaaagaagaggcttttctaaggagtt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19172333 |
cggtttcattgtcttcgtcgtcaagaaaagaacgagcaagattggtgaagatgaaaggatggaggtcagagatccaaagaagaggcttttctaaggagtt |
19172432 |
T |
|
| Q |
318 |
atgccagtcttggttgaggatttgagaagggtctgtg |
354 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19172433 |
atgccagtcttggttgaggatttgagaagggtctgtg |
19172469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University