View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10916_high_26 (Length: 326)
Name: NF10916_high_26
Description: NF10916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10916_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 284; Significance: 1e-159; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 1 - 304
Target Start/End: Complemental strand, 47424704 - 47424401
Alignment:
| Q |
1 |
aacatcaatttgtactgcttatgaaaggcattgtggggaagcagatgcttatatcggcattaacagaagtgcaacaacaggtacgtagattagatggttt |
100 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47424704 |
aacatcaatttgtacggcttatgaaaggcattgtggggaagcagatgcttatatcaacattaacagaagtgcaccaacaggtacgtagattagatggttt |
47424605 |
T |
 |
| Q |
101 |
ctgcagtgttgtagatgatttttcgtaaggtcgctgaaaattgatttcaaggttatgctaagaataatccttttttcttctagagaagaggcaacctagg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47424604 |
ctgcagtgttgtagatgatttttcgtaaggtcgttgaaaattgatttcaaggttatgctaagaataatccttttttcttctagagaagaggcaacctagg |
47424505 |
T |
 |
| Q |
201 |
ttcagcagcaactgttcgagagataacattaacgatgcgaacactagaactctgaaggtctaccacagatgaaagtatagggatggatgtaattaggaag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47424504 |
ttcagcagcaactgttcgagagataacattaacgatgcgaacactagaactctgaaggtctaccacagatgaaagtatagggatggatgtaattaggaag |
47424405 |
T |
 |
| Q |
301 |
tagt |
304 |
Q |
| |
|
|||| |
|
|
| T |
47424404 |
tagt |
47424401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 9 - 96
Target Start/End: Complemental strand, 47391129 - 47391042
Alignment:
| Q |
9 |
tttgtactgcttatgaaaggcattgtggggaagcagatgcttatatcggcattaacagaagtgcaacaacaggtacgtagattagatg |
96 |
Q |
| |
|
||||||| |||||||||||| ||||||||| | |||||||||| ||||||||| ||||||||||||||||| | ||| |||||| |
|
|
| T |
47391129 |
tttgtacggcttatgaaagggattgtgggggatcagatgcttaggatagcattaacaaaagtgcaacaacaggtaggcagaatagatg |
47391042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 9 - 96
Target Start/End: Complemental strand, 47419492 - 47419405
Alignment:
| Q |
9 |
tttgtactgcttatgaaaggcattgtggggaagcagatgcttatatcggcattaacagaagtgcaacaacaggtacgtagattagatg |
96 |
Q |
| |
|
||||||| |||||||||||| ||||||||| | |||||||||| |||||| || ||||||||||||||||| ||||| |||||| |
|
|
| T |
47419492 |
tttgtacggcttatgaaagggattgtgggggatcagatgcttaggatagcattagcaaaagtgcaacaacaggtaggtagaatagatg |
47419405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 9 - 100
Target Start/End: Complemental strand, 47421964 - 47421873
Alignment:
| Q |
9 |
tttgtactgcttatgaaaggcattgtggggaagcagatgcttatatcggcattaacagaagtgcaacaacaggtacgtagattagatggttt |
100 |
Q |
| |
|
||||||| |||||||||||| ||||||||| | | |||||||| |||||| || ||||||||||||||||| ||||| ||||| |||| |
|
|
| T |
47421964 |
tttgtacggcttatgaaagggattgtgggggatccgatgcttaggatagcattagcaaaagtgcaacaacaggtaggtagaatagatagttt |
47421873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University