View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10916_high_33 (Length: 280)

Name: NF10916_high_33
Description: NF10916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10916_high_33
NF10916_high_33
[»] chr3 (1 HSPs)
chr3 (171-273)||(39489843-39489942)


Alignment Details
Target: chr3 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 171 - 273
Target Start/End: Complemental strand, 39489942 - 39489843
Alignment:
171 ttatttatttcttgatgaactgatatgttctaaaatgttgttgtcagtgctactatgtacaattgtggaataagacctacgaaatttgtttgcccctttg 270  Q
    |||||||||||||||||||||||||||||||| ||||||||   || ||| | | |||||||||||||||||||||||||||||||||||||||||||||    
39489942 ttatttatttcttgatgaactgatatgttctacaatgttgt---caatgccattgtgtacaattgtggaataagacctacgaaatttgtttgcccctttg 39489846  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University