View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10916_high_33 (Length: 280)
Name: NF10916_high_33
Description: NF10916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10916_high_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 69; Significance: 5e-31; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 171 - 273
Target Start/End: Complemental strand, 39489942 - 39489843
Alignment:
| Q |
171 |
ttatttatttcttgatgaactgatatgttctaaaatgttgttgtcagtgctactatgtacaattgtggaataagacctacgaaatttgtttgcccctttg |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| || ||| | | ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39489942 |
ttatttatttcttgatgaactgatatgttctacaatgttgt---caatgccattgtgtacaattgtggaataagacctacgaaatttgtttgcccctttg |
39489846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University