View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10916_high_35 (Length: 264)
Name: NF10916_high_35
Description: NF10916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10916_high_35 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 143 - 248
Target Start/End: Complemental strand, 36892780 - 36892675
Alignment:
| Q |
143 |
aggtagtgttatgaatggcacttggtatttttattagaatttcgttaaccatttcaactattccattttttgctgcaaccaaaaatggtgtcatcttttt |
242 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36892780 |
aggtagtgttatgaatggcacttggtacttttattagaatttcgttaaccatttcaactattccattttttgctgcaaccaaaaatggtgtcatcttttt |
36892681 |
T |
|
| Q |
243 |
cttgat |
248 |
Q |
| |
|
|||||| |
|
|
| T |
36892680 |
cttgat |
36892675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 148 - 234
Target Start/End: Complemental strand, 36881685 - 36881599
Alignment:
| Q |
148 |
gtgttatgaatggcacttggtatttttattagaatttcgttaaccatttcaactattccattttttgctgcaaccaaaaatggtgtc |
234 |
Q |
| |
|
|||| ||||||||||||||| ||||| ||||| ||||||||||| |||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
36881685 |
gtgtcatgaatggcacttggaattttgtctagaaattcgttaaccagttcaactattccatttttcgctgcaaccaaaaatggtgtc |
36881599 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 19 - 56
Target Start/End: Original strand, 36890337 - 36890374
Alignment:
| Q |
19 |
acggacacctcttggacatagctattccgtttatattt |
56 |
Q |
| |
|
|||||||||||||||| || |||||||||||||||||| |
|
|
| T |
36890337 |
acggacacctcttggatatggctattccgtttatattt |
36890374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University