View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10916_high_40 (Length: 240)
Name: NF10916_high_40
Description: NF10916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10916_high_40 |
 | |
|
| [»] scaffold0199 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 58 - 225
Target Start/End: Original strand, 10985143 - 10985310
Alignment:
| Q |
58 |
attgttacaatttcaggtgtgttatgaaagctgttatgtaagctcataatgtatcatccatctttttggatcaatctttctctaaaatatgtttgagact |
157 |
Q |
| |
|
||||||| ||| ||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10985143 |
attgttataatctcaggtgtgttttgaaagctgttatgtaagctcataatgtatcatccgtctttttggatcaatctttctctaaaatatgtttgagact |
10985242 |
T |
|
| Q |
158 |
tccaattgtcaactcgtttaaagttgttatggtgtaaccaccttatgcttcacattgtattttgcaag |
225 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
10985243 |
tccaattgtcaactcgtttcaagttgttatggtgtaaccatcttatgcttcacattgtattttgcaag |
10985310 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0199 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: scaffold0199
Description:
Target: scaffold0199; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 43
Target Start/End: Complemental strand, 9330 - 9288
Alignment:
| Q |
1 |
tatatgctattaattaataactctttataaggcagtatttaat |
43 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
9330 |
tatatgctattaattaataactctttataaggtagtatttaat |
9288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University