View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10916_high_42 (Length: 223)
Name: NF10916_high_42
Description: NF10916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10916_high_42 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 15702322 - 15702524
Alignment:
| Q |
1 |
tgcatttatttagatttgaagaggcttgggttaaggatgatagatgtgaagatttaattaaagaagcctggcgcagaacaccaaatcaatgcacagagaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15702322 |
tgcatttatttagatttgaagaggcttgggttaaggatgatagatgtgaggatttaattaaagaagcctggcgcagaacaccaaatcaatgcacagagaa |
15702421 |
T |
|
| Q |
101 |
gctgcaggctgttcagacaattgatgagacttttaaggaatatagaacaggggctgttagcaaagaaataaagagaattgaagagctgctcaaagacacc |
200 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
15702422 |
gctgcagactgttcagacaattgatgagacttttaaggaatatagaacatgggctgttagcaaagaaataaagagagttgaagagctgcttaaagacacc |
15702521 |
T |
|
| Q |
201 |
aat |
203 |
Q |
| |
|
||| |
|
|
| T |
15702522 |
aat |
15702524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University