View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10916_high_48 (Length: 202)
Name: NF10916_high_48
Description: NF10916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10916_high_48 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 94; Significance: 4e-46; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 59 - 187
Target Start/End: Complemental strand, 40513586 - 40513465
Alignment:
| Q |
59 |
atatgattgtagacatctgcttagatattaacctcatcctcatggtgaataaattgaactacatcataaagtggtagtttcacttttagtgtttattgac |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
40513586 |
atatgattgtagacatctgcttagatattaacctcat------ggtgaataaattgaactacatca-aaagtggtagtttcacttttagtgtttattcac |
40513494 |
T |
 |
| Q |
159 |
aggatacaaatttctggggagcagttcat |
187 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40513493 |
aggatacaaatttctggggagcagttcat |
40513465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University