View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10916_low_10 (Length: 469)
Name: NF10916_low_10
Description: NF10916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10916_low_10 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-113; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-113
Query Start/End: Original strand, 1 - 254
Target Start/End: Complemental strand, 5028014 - 5027759
Alignment:
| Q |
1 |
atctctttttatattctaccactagtaatagtttatttaatcgacaaaactactggtactagttttttgtattctaaaataaatagcaaatattaaca-- |
98 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5028014 |
atctctttttatattctaccactagtactagtttatttaatcgacaaaactactagtactagttttttgtattctaaaataaatagcaaatattaacaaa |
5027915 |
T |
 |
| Q |
99 |
gnnnnnnntgtatggtcaaagggaccccttagttgactatcaacaatcaaatttcaaatccaaccacgaatttcctacatcaaccccaagcgagtacact |
198 |
Q |
| |
|
| |||||||||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5027914 |
gaaaaaaatgtatggtcaaagggaccccttagttgattatcaacaatcaaattccaaatccaaccacgaatttcctacatcaaccccaagcgagtacact |
5027815 |
T |
 |
| Q |
199 |
atatcttccctgctccatcccgcacgcaataactccaaccccaaaacactcacgtg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5027814 |
atatcttccctgctccatcccgcacgcaataactccaaccccaaaacactcacgtg |
5027759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000007
Query Start/End: Original strand, 325 - 363
Target Start/End: Complemental strand, 5027688 - 5027650
Alignment:
| Q |
325 |
cacccaccttccctcaacctccgcagcaccccatccata |
363 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5027688 |
cacccaccttccctcaacctccgcagcaccccatccata |
5027650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University