View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10916_low_14 (Length: 426)
Name: NF10916_low_14
Description: NF10916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10916_low_14 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 151 - 421
Target Start/End: Original strand, 29392214 - 29392472
Alignment:
| Q |
151 |
catctttaagtgagtgcgtgtgttctggtgaggtgccacggctgcaccaagaagaatcacatgagaaatgaaatttaggtaannnnnnngcaaggacaac |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
29392214 |
catctttaagtgagtgcgtgtgttctggtgaggtgccacggctgcaccaagaagaatcacatgagaaatgaaatttaggtaatttttttgcaaggacaac |
29392313 |
T |
 |
| Q |
251 |
ccactagcttaattatagataagtttatatgattaaa--atatgtaagtttgataaaatttattatttcatgaacttgcagcattcttttcactagctta |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29392314 |
ccactagcttaattatagataagtttatatgattaaaatatatgtaagtttgataaaatttattatttcatgaacttgcagcattcttttcactagctta |
29392413 |
T |
 |
| Q |
349 |
tatcatttttcatatattattttaaatagagtttaagcttaaaattatagcatgtctctttttctctgcttct |
421 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29392414 |
tatc--------------attttaaatagagtttaagcttaaaattatagcatgtctctttttctctgcttct |
29392472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 71; E-Value: 5e-32
Query Start/End: Original strand, 20 - 119
Target Start/End: Original strand, 29392083 - 29392182
Alignment:
| Q |
20 |
ttttagtaatctagtactaatttcatgtgatgctttattcgggatgggtcaagtcac--tatattatattgttagttttttattgtattttaatttatgc |
117 |
Q |
| |
|
||||||||||||||||| || |||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29392083 |
ttttagtaatctagtac-aagttcatgtgatgctt-attcgggatgggtcaagtcacactatattatattgttagttttttattgtattttaatttatgc |
29392180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University