View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10916_low_31 (Length: 324)
Name: NF10916_low_31
Description: NF10916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10916_low_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 248; Significance: 1e-138; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 248; E-Value: 1e-138
Query Start/End: Original strand, 1 - 316
Target Start/End: Original strand, 688699 - 689032
Alignment:
| Q |
1 |
ccacatgccatgatgacttcttcaattcacaaatgagcttgaaaatgaattattgggaggacaatatgtttagaaggtagctcattttgcataatattta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
688699 |
ccacatgccatgatgacttcttcaattcacaaatgagcttgaaaatgaattattaggaggacagtatgtttagaaggtagctcattttgcataatattta |
688798 |
T |
 |
| Q |
101 |
taggaatagctgtcagtatgtatgt--------ttagtagtgattgtattttttgatgag-----------taattaattagttttaatagtaattttat |
181 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
688799 |
taggaatagctgtcagtatgtatgtatgtatgtttagtagtgattgtattttttgatgagaaatcaatgagtaattaattagttttaatagtaattttat |
688898 |
T |
 |
| Q |
182 |
aattaagtttggggatgaaaactatgaattagacggctgcatggtatttgtctttcatcgatcctccggctcttgttcttgcagttacacaatttccctt |
281 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
688899 |
aattaagtttggggatgaaaactatgaattagacggctgcatggtatt-gtctttcatcgatcctccggctcttgttcttgcagttacacaatttccctt |
688997 |
T |
 |
| Q |
282 |
ttacaagcttattttttgttcatgctgtctctgct |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
688998 |
ttacaagcttattttttgttcatgctgtctatgct |
689032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University