View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10916_low_49 (Length: 203)
Name: NF10916_low_49
Description: NF10916
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10916_low_49 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 16 - 189
Target Start/End: Complemental strand, 32413949 - 32413776
Alignment:
| Q |
16 |
aagaaactaggtggaaagtattccatattaccagcaacagatatatctaattgctggacgttgtgcgaaacagcatattttacaannnnnnnnagtaggt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32413949 |
aagaaactaggtggaaagtattccatattaccagcaacagatacatctaattgctggacgttgtgcgaaacagcatattttacaatttttttgagtaggt |
32413850 |
T |
|
| Q |
116 |
aaggctctacgattgcagtgcggcaaaaatccacagtatgcaatgaggttgagtcatttcgaagagacaaaact |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32413849 |
aaggctctacgattgcagtgcggcaaaaatccacagtatgcaatgaggttgagtcatttcgaagagacaaaact |
32413776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University