View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10918_high_15 (Length: 220)
Name: NF10918_high_15
Description: NF10918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10918_high_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 13 - 133
Target Start/End: Complemental strand, 5774041 - 5773921
Alignment:
| Q |
13 |
caaaggcacaacttttagattctcttggaactaacataaatagtacaaattcaatcacccttcacaatttatttttatatcaaaactaagtttatttttc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5774041 |
caaaggcacaacttttagattctcttggaactaacataaatagtacaaattcaatcacccttcacaatttatttttatatcaaaactaagtttatttttc |
5773942 |
T |
|
| Q |
113 |
aaagtcgatgaccacaactta |
133 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
5773941 |
acagtcgatgaccacaactta |
5773921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 132 - 199
Target Start/End: Complemental strand, 5773775 - 5773708
Alignment:
| Q |
132 |
taggagtctaccaaattaatttagaatatcattttttgtttgttttacatacttagttagtgaagaaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5773775 |
taggagtctaccaaattaatttagaatatcattttttgtttgttttacatacttagttagtgaagaaa |
5773708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University