View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10918_high_17 (Length: 211)
Name: NF10918_high_17
Description: NF10918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10918_high_17 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 23 - 196
Target Start/End: Complemental strand, 9338946 - 9338773
Alignment:
| Q |
23 |
gacattttccattagtcgtttttcttctttacgagcactacgttggatagccaaatggtatacttagcttcttagatgaatcatgcctttaggagatcct |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9338946 |
gacattttccattagtcgtttttcttctttacgagcactacgttggatagccaaatggtatacttagcttcttagatgaatcatgcctttaggagatcct |
9338847 |
T |
 |
| Q |
123 |
ccaacaccctgtttgaggcttcaaccttttcaggtgactgcttccgcctctactgtacaacgtataacgttttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
9338846 |
ccaacaccctgtttgaggcttcaaccttttcaggtgactgcttccgcctctactgtacaacgtataaagttttt |
9338773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University