View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10918_low_15 (Length: 241)
Name: NF10918_low_15
Description: NF10918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10918_low_15 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 199; Significance: 1e-108; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 27 - 241
Target Start/End: Original strand, 7009801 - 7010015
Alignment:
| Q |
27 |
actgaggaacaattggctaaggaagtagaataccttatcaggaagggatgggttccttgtttggaatttgagcttgaggttaatctatttacattgcaat |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7009801 |
actgaggaacaattggctaaggaagtagaataccttatcaggaagggatgggttccttgtttggaatttgagcttgaggttaatctatttacattgcaat |
7009900 |
T |
 |
| Q |
127 |
cctttctttcttcctttttaatttagagtttaagtattatacaacgtcggcgaaaaacttttttacacatacaaccaatcagatttttcatgacgccgct |
226 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || || |
|
|
| T |
7009901 |
cctttctttcttcctttttaaattagagtttaagtattatacatcgtcggcgaaaaacttttttacacatacaaccaatcagatttttcatgacaccact |
7010000 |
T |
 |
| Q |
227 |
tttttgtatatactt |
241 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
7010001 |
tttttgtatatactt |
7010015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 19 - 213
Target Start/End: Original strand, 7006699 - 7006890
Alignment:
| Q |
19 |
cacccctcactgaggaacaattggctaaggaagtagaataccttatcaggaagggatgggttccttgtttggaatttgagcttgaggttaatctatttac |
118 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7006699 |
caccccttactgaggatcaattggctaaggaagtagaataccttatcaggaagggatgggttccttgtttggaatttgagcttgaggttaatctatttac |
7006798 |
T |
 |
| Q |
119 |
attgcaatcctttctttcttcctttttaatttagagtttaagtattatacaacgtcggcgaaaaacttttttacacatacaaccaatcagatttt |
213 |
Q |
| |
|
||||||| |||| |||||| ||| ||||||||||||||||||| |||||| |||| ||||||||||||||||||||||| |||| ||||||| |
|
|
| T |
7006799 |
attgcaa--ctttttttctt-cttcttaatttagagtttaagtactatacactatcggtgaaaaacttttttacacatacaatcaattagatttt |
7006890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 33 - 98
Target Start/End: Original strand, 1373791 - 1373856
Alignment:
| Q |
33 |
gaacaattggctaaggaagtagaataccttatcaggaagggatgggttccttgtttggaatttgag |
98 |
Q |
| |
|
||||||||||| || ||||| ||||||||||| ||||||||||||||| |||| |||||||||||| |
|
|
| T |
1373791 |
gaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatttgag |
1373856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 94
Target Start/End: Original strand, 1350498 - 1350559
Alignment:
| Q |
33 |
gaacaattggctaaggaagtagaataccttatcaggaagggatgggttccttgtttggaatt |
94 |
Q |
| |
|
||||||||||| || ||||| ||||||||||| ||||||||||||||| |||| |||||||| |
|
|
| T |
1350498 |
gaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatt |
1350559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 94
Target Start/End: Original strand, 1358404 - 1358465
Alignment:
| Q |
33 |
gaacaattggctaaggaagtagaataccttatcaggaagggatgggttccttgtttggaatt |
94 |
Q |
| |
|
||||||||||| || ||||| ||||||||||| ||||||||||||||| |||| |||||||| |
|
|
| T |
1358404 |
gaacaattggccaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatt |
1358465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 94
Target Start/End: Original strand, 1384152 - 1384213
Alignment:
| Q |
33 |
gaacaattggctaaggaagtagaataccttatcaggaagggatgggttccttgtttggaatt |
94 |
Q |
| |
|
||||||||||| || ||||| ||||||||||| ||||||||||||||| |||| |||||||| |
|
|
| T |
1384152 |
gaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatt |
1384213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 94
Target Start/End: Original strand, 1390257 - 1390318
Alignment:
| Q |
33 |
gaacaattggctaaggaagtagaataccttatcaggaagggatgggttccttgtttggaatt |
94 |
Q |
| |
|
||||||||||| || ||||| ||||||||||| ||||||||||||||| |||| |||||||| |
|
|
| T |
1390257 |
gaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatt |
1390318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 33 - 94
Target Start/End: Original strand, 1394503 - 1394564
Alignment:
| Q |
33 |
gaacaattggctaaggaagtagaataccttatcaggaagggatgggttccttgtttggaatt |
94 |
Q |
| |
|
||||||||||| || ||||| ||||||||||| ||||||||||||||| |||| |||||||| |
|
|
| T |
1394503 |
gaacaattggcgaaagaagttgaataccttataaggaagggatgggttgcttgcttggaatt |
1394564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University