View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10918_low_17 (Length: 221)

Name: NF10918_low_17
Description: NF10918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10918_low_17
NF10918_low_17
[»] chr6 (1 HSPs)
chr6 (156-221)||(972557-972622)


Alignment Details
Target: chr6 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 156 - 221
Target Start/End: Complemental strand, 972622 - 972557
Alignment:
156 agtatctgattgttaatactaccattatgatttaaaacctctgtatcaaattattagttttattaa 221  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
972622 agtatctgattgttaatactaccattatgatttaaaacctctgtatcaaattattagttttattaa 972557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University