View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10918_low_17 (Length: 221)
Name: NF10918_low_17
Description: NF10918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10918_low_17 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 66; Significance: 2e-29; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 156 - 221
Target Start/End: Complemental strand, 972622 - 972557
Alignment:
| Q |
156 |
agtatctgattgttaatactaccattatgatttaaaacctctgtatcaaattattagttttattaa |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
972622 |
agtatctgattgttaatactaccattatgatttaaaacctctgtatcaaattattagttttattaa |
972557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University