View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10919_high_12 (Length: 331)
Name: NF10919_high_12
Description: NF10919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10919_high_12 |
 | |
|
| [»] scaffold0190 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0190 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: scaffold0190
Description:
Target: scaffold0190; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 1 - 317
Target Start/End: Original strand, 12696 - 13012
Alignment:
| Q |
1 |
ttctgaagatgttgctaaggttggtaagaggattgttaggctatagggacacttcctttggggagggtccaggggaagtaagatatatattgggtccgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
12696 |
ttctgaagatgttgctaaggttggtaagaggattgttaggctatagggacacttcctttggggagggtccaggggaagtaagatatatattgggtccgct |
12795 |
T |
|
| Q |
101 |
gggcagatgtgtggatgcctaagggaagtcttcagataagagaccataggatggtgaatcaagctatgatgggaatgttcggcggagactccctactaga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
12796 |
gggcagatgtgtggatgcctaagggaagtcttcagataagagaccataggatggtgaatcaagctatgatgggaatgttcggcggagactccttactaga |
12895 |
T |
|
| Q |
201 |
ggaatatttatttcaagagatattatctctactaggtatgatgttaattatgtattgtccaccatgggagggagatgtggtagtttgtctactgcatttc |
300 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12896 |
ggaatatttctttcaagagatattatctctactaggtatgatgttaattatgtattgtccaccatgggagggagatgtggtagtttgtctactgcatttc |
12995 |
T |
|
| Q |
301 |
caggatggaatgatgtc |
317 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
12996 |
caggatggaatgatgtc |
13012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University