View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10919_high_19 (Length: 216)
Name: NF10919_high_19
Description: NF10919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10919_high_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 36416824 - 36417007
Alignment:
| Q |
18 |
gttgagaggcatagaacaaagagaatggaagttcaatttggtctatttttagaatgtggatttggatggtggagagtaaaaggtgggagagggnnnnnnn |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36416824 |
gttgagaggcatagaacaaagagaatggaagttcaatttggtctatttttagaatgtggatttggatggtggagagtaaaaggtgggagagggaaaaaaa |
36416923 |
T |
|
| Q |
118 |
ngttgcaatgaccagagtgtttttcttttctcttggtgaccaattatgcttttgtgttagtaaatttaaatttaatggtttcat |
201 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36416924 |
aggtgcaatgaccagagtgtttttcttttctcttggtgaccaattatgcttttgtgttagtaaatttaaatttaatggtttcat |
36417007 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University