View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10919_high_19 (Length: 216)

Name: NF10919_high_19
Description: NF10919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10919_high_19
NF10919_high_19
[»] chr3 (1 HSPs)
chr3 (18-201)||(36416824-36417007)


Alignment Details
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 18 - 201
Target Start/End: Original strand, 36416824 - 36417007
Alignment:
18 gttgagaggcatagaacaaagagaatggaagttcaatttggtctatttttagaatgtggatttggatggtggagagtaaaaggtgggagagggnnnnnnn 117  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||           
36416824 gttgagaggcatagaacaaagagaatggaagttcaatttggtctatttttagaatgtggatttggatggtggagagtaaaaggtgggagagggaaaaaaa 36416923  T
118 ngttgcaatgaccagagtgtttttcttttctcttggtgaccaattatgcttttgtgttagtaaatttaaatttaatggtttcat 201  Q
     | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36416924 aggtgcaatgaccagagtgtttttcttttctcttggtgaccaattatgcttttgtgttagtaaatttaaatttaatggtttcat 36417007  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University